ID: 1033256945

View in Genome Browser
Species Human (GRCh38)
Location 7:139809728-139809750
Sequence GGTGAATCCACACTCACTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033256945_1033256947 -2 Left 1033256945 7:139809728-139809750 CCGAGAGTGAGTGTGGATTCACC No data
Right 1033256947 7:139809749-139809771 CCTGCCTTTTTGTTCTATCCAGG 0: 5
1: 25
2: 159
3: 388
4: 904
1033256945_1033256949 13 Left 1033256945 7:139809728-139809750 CCGAGAGTGAGTGTGGATTCACC No data
Right 1033256949 7:139809764-139809786 TATCCAGGTCCAAAGCTGAATGG 0: 1
1: 0
2: 1
3: 9
4: 123
1033256945_1033256950 14 Left 1033256945 7:139809728-139809750 CCGAGAGTGAGTGTGGATTCACC No data
Right 1033256950 7:139809765-139809787 ATCCAGGTCCAAAGCTGAATGGG No data
1033256945_1033256952 17 Left 1033256945 7:139809728-139809750 CCGAGAGTGAGTGTGGATTCACC No data
Right 1033256952 7:139809768-139809790 CAGGTCCAAAGCTGAATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033256945 Original CRISPR GGTGAATCCACACTCACTCT CGG (reversed) Intronic