ID: 1033256946

View in Genome Browser
Species Human (GRCh38)
Location 7:139809749-139809771
Sequence CCTGGATAGAACAAAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 3, 1: 17, 2: 30, 3: 69, 4: 235}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033256946_1033256950 -7 Left 1033256946 7:139809749-139809771 CCTGCCTTTTTGTTCTATCCAGG 0: 3
1: 17
2: 30
3: 69
4: 235
Right 1033256950 7:139809765-139809787 ATCCAGGTCCAAAGCTGAATGGG No data
1033256946_1033256955 15 Left 1033256946 7:139809749-139809771 CCTGCCTTTTTGTTCTATCCAGG 0: 3
1: 17
2: 30
3: 69
4: 235
Right 1033256955 7:139809787-139809809 GTGGTGCCCGTCCATGTTGAGGG No data
1033256946_1033256952 -4 Left 1033256946 7:139809749-139809771 CCTGCCTTTTTGTTCTATCCAGG 0: 3
1: 17
2: 30
3: 69
4: 235
Right 1033256952 7:139809768-139809790 CAGGTCCAAAGCTGAATGGGTGG No data
1033256946_1033256949 -8 Left 1033256946 7:139809749-139809771 CCTGCCTTTTTGTTCTATCCAGG 0: 3
1: 17
2: 30
3: 69
4: 235
Right 1033256949 7:139809764-139809786 TATCCAGGTCCAAAGCTGAATGG 0: 1
1: 0
2: 1
3: 9
4: 123
1033256946_1033256954 14 Left 1033256946 7:139809749-139809771 CCTGCCTTTTTGTTCTATCCAGG 0: 3
1: 17
2: 30
3: 69
4: 235
Right 1033256954 7:139809786-139809808 GGTGGTGCCCGTCCATGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033256946 Original CRISPR CCTGGATAGAACAAAAAGGC AGG (reversed) Intronic