ID: 1033256947

View in Genome Browser
Species Human (GRCh38)
Location 7:139809749-139809771
Sequence CCTGCCTTTTTGTTCTATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1481
Summary {0: 5, 1: 25, 2: 159, 3: 388, 4: 904}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033256941_1033256947 29 Left 1033256941 7:139809697-139809719 CCAAGAGCAGGAGAAAAAGGGTG 0: 1
1: 2
2: 23
3: 135
4: 604
Right 1033256947 7:139809749-139809771 CCTGCCTTTTTGTTCTATCCAGG 0: 5
1: 25
2: 159
3: 388
4: 904
1033256944_1033256947 4 Left 1033256944 7:139809722-139809744 CCAGCTCCGAGAGTGAGTGTGGA 0: 1
1: 0
2: 2
3: 16
4: 118
Right 1033256947 7:139809749-139809771 CCTGCCTTTTTGTTCTATCCAGG 0: 5
1: 25
2: 159
3: 388
4: 904
1033256942_1033256947 5 Left 1033256942 7:139809721-139809743 CCCAGCTCCGAGAGTGAGTGTGG No data
Right 1033256947 7:139809749-139809771 CCTGCCTTTTTGTTCTATCCAGG 0: 5
1: 25
2: 159
3: 388
4: 904
1033256945_1033256947 -2 Left 1033256945 7:139809728-139809750 CCGAGAGTGAGTGTGGATTCACC No data
Right 1033256947 7:139809749-139809771 CCTGCCTTTTTGTTCTATCCAGG 0: 5
1: 25
2: 159
3: 388
4: 904

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033256947 Original CRISPR CCTGCCTTTTTGTTCTATCC AGG Intronic