ID: 1033256948

View in Genome Browser
Species Human (GRCh38)
Location 7:139809753-139809775
Sequence TGGACCTGGATAGAACAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1002
Summary {0: 1, 1: 5, 2: 45, 3: 233, 4: 718}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033256948_1033256952 -8 Left 1033256948 7:139809753-139809775 CCTTTTTGTTCTATCCAGGTCCA 0: 1
1: 5
2: 45
3: 233
4: 718
Right 1033256952 7:139809768-139809790 CAGGTCCAAAGCTGAATGGGTGG No data
1033256948_1033256954 10 Left 1033256948 7:139809753-139809775 CCTTTTTGTTCTATCCAGGTCCA 0: 1
1: 5
2: 45
3: 233
4: 718
Right 1033256954 7:139809786-139809808 GGTGGTGCCCGTCCATGTTGAGG No data
1033256948_1033256955 11 Left 1033256948 7:139809753-139809775 CCTTTTTGTTCTATCCAGGTCCA 0: 1
1: 5
2: 45
3: 233
4: 718
Right 1033256955 7:139809787-139809809 GTGGTGCCCGTCCATGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033256948 Original CRISPR TGGACCTGGATAGAACAAAA AGG (reversed) Intronic