ID: 1033256950

View in Genome Browser
Species Human (GRCh38)
Location 7:139809765-139809787
Sequence ATCCAGGTCCAAAGCTGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033256944_1033256950 20 Left 1033256944 7:139809722-139809744 CCAGCTCCGAGAGTGAGTGTGGA 0: 1
1: 0
2: 2
3: 16
4: 118
Right 1033256950 7:139809765-139809787 ATCCAGGTCCAAAGCTGAATGGG No data
1033256946_1033256950 -7 Left 1033256946 7:139809749-139809771 CCTGCCTTTTTGTTCTATCCAGG 0: 3
1: 17
2: 30
3: 69
4: 235
Right 1033256950 7:139809765-139809787 ATCCAGGTCCAAAGCTGAATGGG No data
1033256945_1033256950 14 Left 1033256945 7:139809728-139809750 CCGAGAGTGAGTGTGGATTCACC No data
Right 1033256950 7:139809765-139809787 ATCCAGGTCCAAAGCTGAATGGG No data
1033256942_1033256950 21 Left 1033256942 7:139809721-139809743 CCCAGCTCCGAGAGTGAGTGTGG No data
Right 1033256950 7:139809765-139809787 ATCCAGGTCCAAAGCTGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033256950 Original CRISPR ATCCAGGTCCAAAGCTGAAT GGG Intronic