ID: 1033256951 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:139809767-139809789 |
| Sequence | CACCCATTCAGCTTTGGACC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1033256951_1033256955 | -3 | Left | 1033256951 | 7:139809767-139809789 | CCAGGTCCAAAGCTGAATGGGTG | No data | ||
| Right | 1033256955 | 7:139809787-139809809 | GTGGTGCCCGTCCATGTTGAGGG | No data | ||||
| 1033256951_1033256954 | -4 | Left | 1033256951 | 7:139809767-139809789 | CCAGGTCCAAAGCTGAATGGGTG | No data | ||
| Right | 1033256954 | 7:139809786-139809808 | GGTGGTGCCCGTCCATGTTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1033256951 | Original CRISPR | CACCCATTCAGCTTTGGACC TGG (reversed) | Intronic | ||