ID: 1033256951

View in Genome Browser
Species Human (GRCh38)
Location 7:139809767-139809789
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033256951_1033256955 -3 Left 1033256951 7:139809767-139809789 CCAGGTCCAAAGCTGAATGGGTG No data
Right 1033256955 7:139809787-139809809 GTGGTGCCCGTCCATGTTGAGGG No data
1033256951_1033256954 -4 Left 1033256951 7:139809767-139809789 CCAGGTCCAAAGCTGAATGGGTG No data
Right 1033256954 7:139809786-139809808 GGTGGTGCCCGTCCATGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033256951 Original CRISPR CACCCATTCAGCTTTGGACC TGG (reversed) Intronic