ID: 1033256952

View in Genome Browser
Species Human (GRCh38)
Location 7:139809768-139809790
Sequence CAGGTCCAAAGCTGAATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033256944_1033256952 23 Left 1033256944 7:139809722-139809744 CCAGCTCCGAGAGTGAGTGTGGA 0: 1
1: 0
2: 2
3: 16
4: 118
Right 1033256952 7:139809768-139809790 CAGGTCCAAAGCTGAATGGGTGG No data
1033256945_1033256952 17 Left 1033256945 7:139809728-139809750 CCGAGAGTGAGTGTGGATTCACC No data
Right 1033256952 7:139809768-139809790 CAGGTCCAAAGCTGAATGGGTGG No data
1033256948_1033256952 -8 Left 1033256948 7:139809753-139809775 CCTTTTTGTTCTATCCAGGTCCA 0: 1
1: 5
2: 45
3: 233
4: 718
Right 1033256952 7:139809768-139809790 CAGGTCCAAAGCTGAATGGGTGG No data
1033256942_1033256952 24 Left 1033256942 7:139809721-139809743 CCCAGCTCCGAGAGTGAGTGTGG No data
Right 1033256952 7:139809768-139809790 CAGGTCCAAAGCTGAATGGGTGG No data
1033256946_1033256952 -4 Left 1033256946 7:139809749-139809771 CCTGCCTTTTTGTTCTATCCAGG 0: 3
1: 17
2: 30
3: 69
4: 235
Right 1033256952 7:139809768-139809790 CAGGTCCAAAGCTGAATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033256952 Original CRISPR CAGGTCCAAAGCTGAATGGG TGG Intronic