ID: 1033256954

View in Genome Browser
Species Human (GRCh38)
Location 7:139809786-139809808
Sequence GGTGGTGCCCGTCCATGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033256948_1033256954 10 Left 1033256948 7:139809753-139809775 CCTTTTTGTTCTATCCAGGTCCA 0: 1
1: 5
2: 45
3: 233
4: 718
Right 1033256954 7:139809786-139809808 GGTGGTGCCCGTCCATGTTGAGG No data
1033256953_1033256954 -10 Left 1033256953 7:139809773-139809795 CCAAAGCTGAATGGGTGGTGCCC No data
Right 1033256954 7:139809786-139809808 GGTGGTGCCCGTCCATGTTGAGG No data
1033256946_1033256954 14 Left 1033256946 7:139809749-139809771 CCTGCCTTTTTGTTCTATCCAGG 0: 3
1: 17
2: 30
3: 69
4: 235
Right 1033256954 7:139809786-139809808 GGTGGTGCCCGTCCATGTTGAGG No data
1033256951_1033256954 -4 Left 1033256951 7:139809767-139809789 CCAGGTCCAAAGCTGAATGGGTG No data
Right 1033256954 7:139809786-139809808 GGTGGTGCCCGTCCATGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033256954 Original CRISPR GGTGGTGCCCGTCCATGTTG AGG Intronic