ID: 1033257452

View in Genome Browser
Species Human (GRCh38)
Location 7:139814537-139814559
Sequence GTGGAAGGCCTCATACAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033257448_1033257452 -2 Left 1033257448 7:139814516-139814538 CCATTGGAGGAAAGAACAGATGT 0: 1
1: 0
2: 2
3: 17
4: 256
Right 1033257452 7:139814537-139814559 GTGGAAGGCCTCATACAAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033257452 Original CRISPR GTGGAAGGCCTCATACAAGG TGG Intronic
900406693 1:2495957-2495979 GAGGAAGGCCTCCGACACGGGGG - Intronic
902444775 1:16455572-16455594 GCAGAAAGCCACATACAAGGTGG - Intronic
905447552 1:38036878-38036900 AGGGAAGGCCTCATGCAGGGTGG - Intergenic
906780517 1:48568940-48568962 GTGCCAGGCCCCATACAAGGTGG - Intronic
911686454 1:100782233-100782255 CAGAAAGGCCTCACACAAGGAGG - Intergenic
912329261 1:108802503-108802525 GTGGAAGACTTGATTCAAGGTGG - Intronic
912953683 1:114137669-114137691 GTGGAAGTTCTCATCAAAGGTGG + Exonic
917409002 1:174738367-174738389 GAGGAGGGCCTTATACAAGTAGG - Intronic
923191283 1:231623146-231623168 CTGGAAGGCATCATACTATGTGG - Intronic
1064142125 10:12799303-12799325 GTGAAAGGCCTCAGCCAATGGGG + Intronic
1064458158 10:15507900-15507922 GTGGAGGGCTTCATACAGAGTGG + Intergenic
1065091889 10:22243737-22243759 GTGTAAGGCTTAATATAAGGTGG - Intergenic
1066220444 10:33333378-33333400 GTGGAGGGCCTCATACCAACAGG - Intronic
1068276241 10:54801658-54801680 GTGGAGGGCTTCATATAAGAGGG - Intronic
1069825111 10:71250141-71250163 GCTGAAGGCCTCTTACCAGGTGG + Intronic
1074412458 10:113240112-113240134 GGAGAAGACCTCACACAAGGAGG - Intergenic
1076908697 10:133376962-133376984 CTGGAAGGCCTGGTGCAAGGAGG - Intergenic
1077360228 11:2137552-2137574 GTGGAAGTTTCCATACAAGGAGG - Intronic
1078005524 11:7529670-7529692 TTGGGAGGCCTCAAACATGGAGG - Intronic
1083732678 11:64661217-64661239 GTGGAGGGGCCCACACAAGGTGG - Intronic
1084680074 11:70661929-70661951 GAGGAAGGAGTCATACATGGTGG + Intronic
1084771656 11:71346528-71346550 CTTGAAGGCCTCATACATGCTGG - Intergenic
1085420184 11:76351149-76351171 GTGGAGGGCTTCATAGATGGTGG + Exonic
1089298030 11:117481444-117481466 ATGGAGGGCTTCATACAGGGAGG + Intronic
1092677816 12:10942188-10942210 GTGGTTGGCCTCCTACCAGGAGG + Intronic
1095561377 12:43570037-43570059 GTGGAGGGCTTCATAGATGGTGG + Intergenic
1099434458 12:82627086-82627108 GTGGACAGCCTCTTACAAGGAGG - Intergenic
1101462105 12:104906462-104906484 GGGGCAGGCCTCAGACCAGGGGG + Intronic
1104996498 12:132661047-132661069 GAGGAAGGCCTCAAACACCGAGG + Exonic
1107105201 13:36635872-36635894 GAGAACGGCCTAATACAAGGTGG - Intergenic
1107855295 13:44609371-44609393 GTGGAAGGTCTCCTAAAATGTGG + Intergenic
1113501322 13:110777117-110777139 GTGGAAAGACACACACAAGGAGG + Intergenic
1114883898 14:26823343-26823365 GCAGAAGGCAGCATACAAGGAGG - Intergenic
1120173459 14:81269839-81269861 GTGGAAGGAATCATAAAAGTTGG - Intronic
1121330891 14:93049259-93049281 GTGGAAGGCCTCCTGCATGCAGG + Intronic
1126914888 15:53455409-53455431 GTGGAATGGGTCACACAAGGAGG + Intergenic
1131926148 15:97386046-97386068 TTGTAAGCCCTCATCCAAGGAGG - Intergenic
1134718284 16:16367698-16367720 GTGGAAGGCCGGCCACAAGGAGG + Intergenic
1136655293 16:31705835-31705857 GTGGAGGGCCACACACCAGGAGG + Intergenic
1139119997 16:64004074-64004096 TTGGAAATCCTCAGACAAGGAGG - Intergenic
1139192823 16:64884424-64884446 GTGGAAGGCCTAATATTAAGAGG - Intergenic
1143362969 17:6386618-6386640 GTGGAAGTCCTCAGAGAAGAAGG - Intergenic
1143382649 17:6506194-6506216 GAGGAAGGCCTCATGCAAAAAGG + Intronic
1145404774 17:22578483-22578505 GAGGAAGGCTTCATAGAAGTAGG + Intergenic
1147131335 17:38411229-38411251 GTGAAAGGTGTGATACAAGGTGG + Intergenic
1147847477 17:43414763-43414785 AAGGAAGGCTTCATAAAAGGGGG - Intergenic
1148587713 17:48792599-48792621 ATGCAAAGCCTCATGCAAGGAGG + Intronic
1149288178 17:55189127-55189149 GCAGAAGGCCTGATGCAAGGGGG + Intergenic
1152226761 17:79096368-79096390 GGGCAAGGCCTCATATAATGGGG - Intronic
1154113658 18:11592197-11592219 GTCAAAGGCCTCACACAAGATGG - Intergenic
1154279748 18:12991739-12991761 GTGGAAGTCCCCAGACAAGAGGG - Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1158789595 18:60761589-60761611 CTGGGAGGCCTCACACATGGTGG - Intergenic
1160460948 18:79037561-79037583 CTGGAAGGCCTGAGACATGGTGG - Intergenic
1163675299 19:18652806-18652828 GTTGATGGCCTTATACAAAGTGG - Intronic
924960235 2:28187-28209 GTGGAAGGCAGCACACAAGATGG + Intergenic
927024254 2:19049328-19049350 TTGGAAGGCCTCAGAGGAGGGGG - Intergenic
927862341 2:26567990-26568012 GTAGAAGGCTTCACACGAGGAGG - Intronic
928198944 2:29234720-29234742 GTGGAGCGCCTCACACATGGTGG + Intronic
928625593 2:33136508-33136530 TTGGAGGGCCACAGACAAGGAGG + Intronic
929556077 2:42926461-42926483 GTGGAAAGGCTCACACAAAGTGG + Intergenic
930568257 2:53050558-53050580 CTGGAAGGCCACAGACAAGCAGG + Intergenic
933776902 2:85776611-85776633 GTGGAGGGCCTCCTGCATGGTGG + Intronic
935800372 2:106689686-106689708 GTGGACGGCCTCTTCCAAAGTGG + Intergenic
936868942 2:117109979-117110001 GTGGCAGGCCTCTTCCAAGATGG - Intergenic
937599505 2:123713346-123713368 ATGGAAAGCCTCATACATGATGG + Intergenic
941019078 2:160388875-160388897 GTGGAAGGCCTCCCCCCAGGGGG - Intronic
941280372 2:163542597-163542619 TTGGAAACCCTCATACATGGTGG - Intergenic
942587184 2:177493942-177493964 GTGGAAGGCTAAATAAAAGGAGG + Intronic
944512114 2:200475155-200475177 GTGCAAGGCCCCTTACAATGTGG + Intronic
946806599 2:223476723-223476745 GTGACAGGTCTCATACAAGGTGG + Intergenic
948059297 2:235031670-235031692 GTGGAAGGCCTAAGAACAGGTGG - Intronic
1174115187 20:48222026-48222048 GTGGAAGGCATCATACGGTGAGG + Intergenic
1174255111 20:49248747-49248769 GTGGAAGGCCTCCTGTATGGTGG - Exonic
1175654969 20:60762031-60762053 GTGGATGGCATCAGAAAAGGGGG + Intergenic
1177486402 21:21762289-21762311 GTGGAAGGAGACATTCAAGGGGG + Intergenic
1179376234 21:40852245-40852267 ATGGAAGGCCCCTTGCAAGGAGG + Intergenic
1180257425 21:46641795-46641817 GTGGAAGGCCGCACACCGGGGGG + Intronic
1181473413 22:23154381-23154403 GTGGAAGTCCTGAGAGAAGGGGG - Intronic
949748155 3:7319312-7319334 GTGGAAGGGTTCATTTAAGGGGG + Intronic
951943382 3:28107448-28107470 GTAGAAAGCCTCATGCAATGAGG - Intergenic
952955501 3:38554779-38554801 ATGGAAGGCCTCATGGAAGATGG - Intronic
955638344 3:61054798-61054820 CTGGAAAGCTTCATAGAAGGAGG - Intronic
956793461 3:72698167-72698189 CTGGCAAGCTTCATACAAGGAGG - Intergenic
957009974 3:74993175-74993197 TTGGAAGGCTTCATAGATGGGGG - Intergenic
957865267 3:86014815-86014837 GTGGAGGGCTTCATAGATGGTGG - Intronic
963080931 3:141393270-141393292 GAGCAAGGCCTCAGACAGGGTGG - Intronic
963187107 3:142430642-142430664 GTGGAAGTCATCAAAGAAGGTGG - Intronic
967467711 3:189826819-189826841 GTTGAAGGCCCCATACTATGAGG + Intronic
969075193 4:4572633-4572655 GTGGAAGGCATGATAGCAGGAGG - Intergenic
969627828 4:8316653-8316675 GTGGGAGGCCTCATCCCAGGCGG - Intergenic
969965200 4:10986902-10986924 GTGGAGGGCCTCATATAAATAGG + Intergenic
972355356 4:38275443-38275465 GTGCAAGACCTCATCCATGGAGG + Intergenic
973029809 4:45323519-45323541 GTGGAATGCTTCATACATGGGGG + Intergenic
975008834 4:69323410-69323432 GTCCAAGGCCTCATACATGCAGG + Intronic
975208927 4:71676683-71676705 CTGGCAGTGCTCATACAAGGTGG - Intergenic
975554150 4:75643573-75643595 ATGGAAGACCTCATTCAAAGGGG + Exonic
975670930 4:76779923-76779945 GAGGAAGGCCTCATGCACTGCGG + Exonic
978586974 4:110283979-110284001 GTGGCAGGCCGCTTCCAAGGTGG + Intergenic
981567716 4:146117957-146117979 GTGGAAAGAGTCACACAAGGAGG + Intergenic
982163361 4:152591921-152591943 TTGGAAGGGCTCATGCAAGTTGG + Intergenic
985822374 5:2169056-2169078 GTGGAGGGCCTGATAAAAGCCGG - Intergenic
990510686 5:56486781-56486803 CTGGAAGTCATCATGCAAGGTGG + Intergenic
992326715 5:75667050-75667072 TTGGAAGACCTCACACCAGGAGG - Intronic
995403556 5:111768215-111768237 GTGGAATGACTTATACCAGGGGG + Intronic
998138829 5:139688673-139688695 GAGGAAGGCATCATACAGGTGGG - Intergenic
999638467 5:153647000-153647022 GTGGAGGGCCCCACAAAAGGAGG - Exonic
1004240664 6:13918199-13918221 GGGGAAGGTCGCATTCAAGGTGG + Intergenic
1006130458 6:31865929-31865951 GTGGAAGGCCCAGTAGAAGGAGG + Exonic
1006301547 6:33196088-33196110 GTCAAAAGCCTCTTACAAGGGGG - Intronic
1006384292 6:33720816-33720838 GAAGAAGGCCTCATACATGAGGG + Intergenic
1010123072 6:72402069-72402091 GTGGAGTGACTCATAAAAGGAGG - Intronic
1020468884 7:8513089-8513111 GTGGAAGACATCATAGAAGAAGG + Intronic
1033257452 7:139814537-139814559 GTGGAAGGCCTCATACAAGGTGG + Intronic
1035214207 7:157352646-157352668 GTGGATGGTCTCACACAATGAGG - Intronic
1035758423 8:2051375-2051397 GGGGATGGCCTCATACAGGATGG + Intronic
1036553261 8:9833854-9833876 ATGGAAGGCCTCCTACACGGAGG - Intergenic
1037796857 8:22002891-22002913 CTGGAAGGGATCATGCAAGGTGG + Intronic
1037971312 8:23173898-23173920 GTGGGAGGCCTCAGGCATGGCGG + Intergenic
1040064390 8:43133418-43133440 GTGGAAGGCCTCCTTAAATGAGG + Intergenic
1052078636 9:24176150-24176172 GTGCTAGGCCTTATACATGGGGG - Intergenic
1052877800 9:33580469-33580491 GTTGAAGCCCTCACACAGGGAGG + Intergenic
1053498183 9:38563736-38563758 GTGGAAGCCCTCACACAGGGAGG - Intronic
1053913453 9:42927838-42927860 GTTGAAGCCCCCATACAGGGAGG + Intergenic
1055188293 9:73484342-73484364 GTGAACCGCCTCATACAATGAGG - Intergenic
1057677652 9:97148232-97148254 GTTGAAGCCCTCACACAAGGAGG - Intergenic
1059530372 9:115030128-115030150 TTGCAAGGCCTCACACATGGGGG + Intronic
1061403677 9:130382239-130382261 GTGCAAGGCCTCCAACGAGGTGG + Intronic
1186554595 X:10544423-10544445 GTGGAAGGCCTCTTTTGAGGAGG + Intronic
1187565059 X:20441339-20441361 TTAGTAGGCCTCATAAAAGGAGG + Intergenic
1187963519 X:24588269-24588291 GAGGAAGGCCAGATACAAGTTGG - Intronic
1189378276 X:40482840-40482862 GTGAAAGGCCTCTTATATGGCGG + Intergenic
1192792531 X:74397154-74397176 GTGGAGGGCTTCATAGATGGTGG + Intergenic
1196898652 X:120362029-120362051 GGGGAAGGGCTCATGCCAGGAGG + Intergenic
1202593630 Y:26513347-26513369 GTGGAAGAACTCACAGAAGGAGG + Intergenic