ID: 1033260531

View in Genome Browser
Species Human (GRCh38)
Location 7:139840318-139840340
Sequence TGGAGGCGGGATGCCTTTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033260531_1033260539 24 Left 1033260531 7:139840318-139840340 CCGGAAAAGGCATCCCGCCTCCA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1033260539 7:139840365-139840387 TGCCCACCATTTCCCAACTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033260531 Original CRISPR TGGAGGCGGGATGCCTTTTC CGG (reversed) Intronic
914402331 1:147334263-147334285 TGGAGCCTGGATGTCTTGTCTGG - Intergenic
916075879 1:161199845-161199867 TGGAGGCGGAATGGCTGTTCTGG - Intronic
918703881 1:187637765-187637787 TGGAGGCTGGATGGCCTTTGGGG - Intergenic
920122516 1:203669392-203669414 TGGAGACTGGATCCCTTTCCAGG + Intronic
920141180 1:203814669-203814691 TGGAGGCTGGAAGACTTTTGAGG - Intronic
922141365 1:222891107-222891129 AGGAGGGGGGATGACTTTTCAGG + Intronic
923750435 1:236741757-236741779 TGTAGGCGGGATGAATTTTAAGG - Intronic
1063532402 10:6847107-6847129 TGGTGGCGGGAAGCCTTTGAAGG - Intergenic
1063822466 10:9853753-9853775 TGGTGGTGGCATGCCTTTCCTGG - Intergenic
1064000551 10:11660554-11660576 TGGGGACAGGATGCCTTTTTGGG + Intergenic
1064842248 10:19606717-19606739 TGCAGGCCTGATCCCTTTTCTGG - Intronic
1067431518 10:46249002-46249024 TGCAGCCTGGATGCCTTCTCAGG + Intergenic
1068719077 10:60222179-60222201 TGCAGGAGGGATGCCTCATCAGG + Intronic
1069438389 10:68406850-68406872 GGGAGGGGCGATGACTTTTCAGG - Exonic
1070513277 10:77180175-77180197 TGGAAGGGTGCTGCCTTTTCTGG - Intronic
1070537310 10:77389412-77389434 TGGAGGAGGGATGGACTTTCAGG + Intronic
1070605922 10:77898540-77898562 AGGAGGAGGCAGGCCTTTTCTGG - Intronic
1070723396 10:78772175-78772197 TGGAGGCCGGATGCCCTCTCTGG - Intergenic
1075987324 10:126799139-126799161 TGGGGGCAGGATTTCTTTTCTGG - Intergenic
1079771697 11:24469726-24469748 TGGAGACCAGATGGCTTTTCTGG - Intergenic
1080639110 11:34148528-34148550 TGGGGGAGACATGCCTTTTCAGG - Intergenic
1092202678 12:6596168-6596190 GTGAGGAGGGTTGCCTTTTCTGG - Intronic
1095662925 12:44759011-44759033 TTGGGGCAGGATGCATTTTCAGG - Intronic
1097733095 12:63151367-63151389 TGGACGAGTCATGCCTTTTCTGG + Intergenic
1098015918 12:66104486-66104508 TGGAGGCCTCTTGCCTTTTCTGG - Intergenic
1104516440 12:129431468-129431490 TGCACACGGGATGCCTTTTGGGG + Intronic
1104637689 12:130448321-130448343 TGGAGAGGGCATGGCTTTTCTGG - Intronic
1104670668 12:130677926-130677948 TGGAGGAGGGGTGCCTTCTGCGG - Intronic
1105619428 13:22052590-22052612 TAGAGCAGGGATGCCTATTCTGG + Intergenic
1109053826 13:57520011-57520033 CGCAGGTGGGATGCCTTTTGGGG - Intergenic
1114407711 14:22472115-22472137 TGGGGGAGGGATGCCTTTCAAGG - Intergenic
1118912973 14:70077368-70077390 TGGAAGCTGAATGCCTTTTCAGG + Intronic
1122828453 14:104383619-104383641 TGGGGCAGGGAGGCCTTTTCAGG - Intergenic
1126337856 15:47606209-47606231 GGGAGGAGGGATGCCATTTAGGG - Intronic
1127535153 15:59883286-59883308 TGGAGGAGGGAGGCCTGATCTGG + Intergenic
1127832013 15:62759264-62759286 CTGACGCCGGATGCCTTTTCTGG + Intronic
1128417357 15:67458871-67458893 TGAAGGCTGGATGCCATTTCTGG + Intronic
1128462145 15:67878502-67878524 TGGAGGGGGGATGTGTTTTAAGG - Intergenic
1132043966 15:98548643-98548665 AGGACGGAGGATGCCTTTTCTGG - Intergenic
1134022441 16:10930342-10930364 TGGAGGTGGGGTGGCTGTTCTGG + Exonic
1136081369 16:27854437-27854459 TGGAGGCCGGCGGCCTTTTAGGG - Intronic
1142759151 17:2033425-2033447 TGGAATAGGGATCCCTTTTCAGG - Intronic
1146256972 17:31397302-31397324 TGGAGGCAGGAGGCCTCCTCGGG + Intronic
1147795299 17:43037872-43037894 TGGTGGCGGGAGGTCTTTCCTGG - Intergenic
1149321743 17:55488274-55488296 TGCAGTCGGGATGCCTCTGCTGG - Intergenic
1157418018 18:47522020-47522042 TGGAGGAGGGATTTCTTTTATGG - Intergenic
1157500211 18:48185198-48185220 TGGAGGAGGGAGGCCATTCCAGG - Intronic
1162341365 19:10093293-10093315 GGGAGGCGGGACTCCTGTTCTGG - Intronic
1163878681 19:19898790-19898812 TGGAGGCTGGATGGCTCTTGGGG - Intergenic
1166976510 19:46608115-46608137 TGGATGCTGGATGCCTTCCCTGG - Intronic
926363317 2:12110594-12110616 TGAAGGGAGGATGCCTGTTCTGG + Intergenic
927486515 2:23491879-23491901 TGGAGGCGAGATGCACTCTCAGG - Intronic
929475841 2:42247398-42247420 TGGAGGCGGGATACTTATTGTGG + Intronic
931918998 2:66992131-66992153 TTGAGGCTGGAGGCCTTTTGAGG - Intergenic
933591044 2:84232995-84233017 TAAAAGAGGGATGCCTTTTCAGG - Intergenic
933679397 2:85086322-85086344 TGGATACGGGGTGCCTTTTAGGG - Intergenic
933777358 2:85779103-85779125 TTGAGCCTGGATGCCTCTTCTGG + Intronic
938288882 2:130139083-130139105 TGGAAGCGGGAGGGCTTTTCTGG - Intergenic
938448179 2:131393634-131393656 TGGAGACGGGAGGGCTTTCCTGG + Intergenic
938467651 2:131533848-131533870 TGGAAGCGGGAGGGCTTTTCTGG + Intergenic
939564151 2:143766811-143766833 TGGCGGCGGGATGGGGTTTCTGG + Intronic
939728358 2:145751798-145751820 TGGAGGATGAATGCCGTTTCAGG + Intergenic
942749486 2:179271553-179271575 TGGAGGTATGATGGCTTTTCTGG + Intergenic
944531478 2:200672159-200672181 TGGATATGGGATTCCTTTTCGGG + Intronic
947643062 2:231717871-231717893 AGGTGTGGGGATGCCTTTTCTGG + Intergenic
948754936 2:240154053-240154075 TGGAGGCAGAATTCCTTCTCTGG + Intergenic
1172952114 20:38728873-38728895 GGGAGGCGGGGTGCATTTGCGGG + Exonic
1174035876 20:47667964-47667986 TGGAGAGGGGAGGCCTTTCCCGG - Intronic
1182173218 22:28254851-28254873 TGGAGGAGGCAGGCCTTTCCAGG - Intronic
1182603803 22:31488646-31488668 TGGAGGCAGGAGGCTTCTTCAGG + Exonic
1182917664 22:34050046-34050068 TGAAGGCTGGATGCCTTGTGAGG + Intergenic
949495536 3:4628159-4628181 TGGAGGCAGGATTCCATTCCAGG - Intronic
951993331 3:28700263-28700285 TGGAGGCTAGAGGACTTTTCTGG + Intergenic
963085145 3:141429348-141429370 TGGCGGCAGGTTGCCTTTTGGGG + Intronic
963741383 3:149085602-149085624 TGGATGCTGGATGTATTTTCTGG - Intronic
963783903 3:149513689-149513711 TGGAGGTGGGGGGCTTTTTCTGG + Intergenic
964230746 3:154464172-154464194 GGGAGGCTGGATACCTTTCCTGG + Intergenic
964813454 3:160691316-160691338 TGGAGATGGGATGCTTTATCTGG - Intergenic
968561272 4:1284010-1284032 GGGAGCCGGGAGGCCTTTACTGG + Intergenic
969074984 4:4570756-4570778 TAGAGGTTGGATACCTTTTCTGG - Intergenic
971259757 4:25045423-25045445 TGGAGGGGGTATTCCTCTTCTGG + Intergenic
978935982 4:114376579-114376601 TGGCTGGGGGATGACTTTTCTGG + Intergenic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
993546450 5:89218713-89218735 TGGATGCAGGATTTCTTTTCAGG - Intergenic
994147171 5:96408533-96408555 TGGCAGCAAGATGCCTTTTCTGG + Intronic
997716708 5:136048023-136048045 TGGAGGCAGGCTGCCCTGTCAGG + Intronic
1001152287 5:169242629-169242651 TGGAGGAGAGAGGCCTTATCAGG + Intronic
1001966733 5:175914778-175914800 TGGAGGTGGGCTGCCCTTTTTGG - Intergenic
1002250215 5:177924426-177924448 TGGAGGTGGGCTGCCCTTTTTGG + Intergenic
1004130361 6:12913565-12913587 TAGAGGTGGGATGATTTTTCTGG + Intronic
1018004430 6:159608336-159608358 TGGAGGTGGGAGGACTTTTCAGG + Intergenic
1024196085 7:47060416-47060438 CAGAGGCTGGAAGCCTTTTCAGG + Intergenic
1031959619 7:127976877-127976899 TGGAGGCAGGAAACCTTTGCTGG + Intronic
1032470470 7:132174849-132174871 TGGAGCCGGGATTCCGTTCCTGG - Exonic
1033260531 7:139840318-139840340 TGGAGGCGGGATGCCTTTTCCGG - Intronic
1033472948 7:141665456-141665478 TGGAGGTGGCAAGCCTTTTGGGG + Intronic
1034246169 7:149646078-149646100 TGGAGGCAGAATTCCTTCTCAGG - Intergenic
1034274333 7:149817491-149817513 TGGAGCCTGGAGCCCTTTTCCGG + Intergenic
1034387426 7:150752218-150752240 TTGAGGTGGAATTCCTTTTCTGG - Intergenic
1034492474 7:151401106-151401128 TGGAGGGAGGATCCCTTTTTAGG - Intronic
1035643413 8:1200559-1200581 TGCAGGCGGGAGGCTCTTTCCGG - Intergenic
1037636617 8:20705884-20705906 TGGAGGGGGGAGGGCTGTTCTGG + Intergenic
1039475267 8:37836305-37836327 TGGAGCCATGTTGCCTTTTCAGG - Intronic
1042894557 8:73651772-73651794 CGGAGACGGGATGCATTTTGAGG + Intronic
1044537030 8:93369211-93369233 TGGAGGCAGGATTCCTTCTTTGG + Intergenic
1044777098 8:95701331-95701353 TGGAGGGGAGAAGCCTTCTCAGG - Intergenic
1047000804 8:120570524-120570546 TGGAGGTGGGATTCCAGTTCCGG - Intronic
1047371695 8:124261255-124261277 TGGAGGCGGGATTCATATGCTGG - Intergenic
1057906064 9:98984357-98984379 TGGAGCCTGGGGGCCTTTTCAGG + Intronic
1187939791 X:24370550-24370572 AGGAGGAAGGATGCCTTCTCAGG - Intergenic
1190489577 X:50968273-50968295 TGGAGGCGGGAGGTCTTTTAAGG - Intergenic
1194356264 X:92888319-92888341 TGGAGGTGGGATGGCCCTTCAGG + Intergenic
1196686294 X:118513300-118513322 TGATGGCTGGATGCCTTTTCTGG + Intronic
1199620841 X:149699315-149699337 TGGAGGAGGGGTCCCTTTTATGG + Intronic
1199740225 X:150728726-150728748 TGCAGGCAGGATCTCTTTTCTGG - Intronic
1200664612 Y:6005319-6005341 TGGAGGTGGGATGGCCATTCAGG + Intergenic