ID: 1033262803

View in Genome Browser
Species Human (GRCh38)
Location 7:139858181-139858203
Sequence GGCTGCTGCCTTGGAACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033262803_1033262806 2 Left 1033262803 7:139858181-139858203 CCATCTGTTCCAAGGCAGCAGCC 0: 1
1: 0
2: 2
3: 37
4: 290
Right 1033262806 7:139858206-139858228 TCCAGTGCCTTCACCTGCTATGG 0: 1
1: 0
2: 0
3: 27
4: 173
1033262803_1033262810 15 Left 1033262803 7:139858181-139858203 CCATCTGTTCCAAGGCAGCAGCC 0: 1
1: 0
2: 2
3: 37
4: 290
Right 1033262810 7:139858219-139858241 CCTGCTATGGTGCCACAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033262803 Original CRISPR GGCTGCTGCCTTGGAACAGA TGG (reversed) Intronic
900286219 1:1901840-1901862 AGCTGCTTCTTTGGGACAGAAGG - Intergenic
900397292 1:2458313-2458335 TCCAGCTGCCTTGGAGCAGATGG + Intronic
901507116 1:9691793-9691815 TGCTGCTGCCTGGGAAAAGAAGG + Intronic
903285606 1:22275008-22275030 GGCTGCTGCTTTAGAAGAGAGGG + Intergenic
903475173 1:23614520-23614542 AGCTGCTGTCAGGGAACAGATGG - Intronic
903567022 1:24275258-24275280 GGCTGAATCCTTGGAACAGAGGG + Intergenic
903766623 1:25739290-25739312 AGCAGCTGCCTTTGAAAAGATGG + Intronic
903952529 1:27004640-27004662 AGCTGCTCCCTTGGAAGAGACGG + Intergenic
904343013 1:29850014-29850036 AGCTGCTGCCTTTGAAAAGCTGG + Intergenic
904435201 1:30490476-30490498 GGGTGCTGGTGTGGAACAGATGG + Intergenic
905346738 1:37316345-37316367 GGCTGCTGCCCTGTGACAGGAGG - Intergenic
905458728 1:38106767-38106789 GGCTGCAGCCTTGGGAAGGATGG + Intergenic
905942485 1:41875071-41875093 GGCTTCTGCCCTGCAAGAGAGGG + Intronic
906311241 1:44756029-44756051 GGGTGCTCCCTGGAAACAGAAGG - Intronic
907844234 1:58189555-58189577 GGATGCTGGGGTGGAACAGAGGG - Intronic
908356442 1:63328315-63328337 GCCTCCTCCCTTGAAACAGACGG - Intergenic
908638585 1:66196396-66196418 AGATGCTGCCTAGGCACAGAAGG + Intronic
911377408 1:97067972-97067994 GGCAGCTGTCTTGAAGCAGAAGG - Intergenic
912200809 1:107455479-107455501 GCCTGCTGCTTTGGAAAAGATGG - Intronic
913994880 1:143643551-143643573 GGCTGGTGCTTTGAAAAAGAGGG - Intergenic
918395149 1:184106503-184106525 GGCTGCTGGATTGGACCAAATGG + Intergenic
922664391 1:227456222-227456244 GGCTGCTGCAATGGAAGAGCTGG - Intergenic
1062960944 10:1573349-1573371 GGCTGCTGCCTGGGATAAAAGGG + Intronic
1066188232 10:33031311-33031333 GTCTGCTCCCGGGGAACAGAGGG + Intergenic
1067469272 10:46524228-46524250 TGCTGGTGCATTGGAACACAGGG + Intergenic
1067822369 10:49541176-49541198 GGCTGATGCCTTAGAAGAAAGGG - Intergenic
1069809936 10:71150970-71150992 GACAGCTGCTTTGGAACAGATGG - Intergenic
1071526772 10:86363818-86363840 CGCGGCTGCCGAGGAACAGAGGG + Intronic
1072718297 10:97765836-97765858 GGCTGCTGCCTTGAGGTAGATGG - Intergenic
1075778352 10:125002101-125002123 GGCTGCTGCCTTGGAATTCATGG + Intronic
1076125538 10:127971209-127971231 GGCTGGCGCATTGGAACAAATGG + Intronic
1076157198 10:128213051-128213073 GGCTGCTGCCTTGGGAGTGACGG + Intergenic
1076712950 10:132348846-132348868 GGCAGCTGCCTGGGGACAAAAGG + Intronic
1077163021 11:1122161-1122183 GGCTGCTGCCTGGGCCAAGAGGG - Intergenic
1077309099 11:1880674-1880696 GGCTGCTGACTTGGAGAAAATGG - Intronic
1077960508 11:7072273-7072295 GTCTGCTGCCTTGGCAGGGATGG + Intergenic
1078721082 11:13883677-13883699 GGCCGCTGCCTTGTAACATGGGG + Intergenic
1080735709 11:35011863-35011885 GGATGCTGCCTAGGAAGAGCAGG + Intronic
1083268347 11:61557669-61557691 GGCTGCAGACTTGGTACAGGAGG - Intronic
1084683313 11:70679606-70679628 GGGTCCTGCCGAGGAACAGAGGG + Intronic
1086936233 11:92748201-92748223 GCCTGCTGCCATGGAAGACACGG - Intronic
1087705135 11:101481582-101481604 GGATTCTGCCTTGGATCAGCAGG - Intronic
1089232321 11:116990069-116990091 GCCTGCTGCCTTCTCACAGAAGG - Intronic
1089629093 11:119772714-119772736 GGCTGCAGCCTGAGCACAGATGG + Intergenic
1092124030 12:6063351-6063373 GGCAGGTGCCCTGGAGCAGAGGG + Intronic
1094125946 12:27022475-27022497 GGCTGCGTCCTTGGAACGGGTGG - Intergenic
1094135589 12:27122007-27122029 GGCTGCGACGTTGGAGCAGATGG + Intergenic
1094185080 12:27633423-27633445 GGCTGCAGCGTTGGAGCAGATGG + Exonic
1094533500 12:31299866-31299888 GTTTGTTGCCTTGGAACAGTAGG - Intronic
1095465943 12:42488157-42488179 GGGGGCTGCCTTGGAACAACAGG - Intronic
1095852963 12:46831017-46831039 GGCTGCTGACTTGGAGGAAAAGG - Intronic
1096198702 12:49665769-49665791 GGCTGCTGGCTGGGCACACAGGG - Intronic
1096544607 12:52328947-52328969 TGGTGCTGCCTTGCAACATATGG + Intergenic
1097187374 12:57203004-57203026 GGCTGCTCCTATGGAACAGCTGG - Intronic
1098575518 12:72037658-72037680 AGCTTCTGCCTGAGAACAGAGGG + Intronic
1099905899 12:88769722-88769744 GCCTGGTGCCTTGGCAGAGATGG + Intergenic
1101041272 12:100758309-100758331 GACTGGTGCCTGGGAGCAGATGG + Intronic
1101128146 12:101660782-101660804 GTCTGCTGCCATGGAAGACATGG - Intronic
1101707357 12:107232914-107232936 GGCTGCTGCGTGAGAACAGAAGG - Intergenic
1103983507 12:124751974-124751996 GGATGTTGCCTTGGAATTGAGGG + Intergenic
1104372921 12:128239069-128239091 GGCTACTCCCTTGTTACAGAAGG - Intergenic
1104925434 12:132311627-132311649 GGCAGCTGCCGTGGGACAGCGGG + Intronic
1105015752 12:132786048-132786070 AGCTGCTCCCTTGGGGCAGAGGG - Intronic
1105257829 13:18756427-18756449 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1105258213 13:18759308-18759330 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1105260489 13:18775736-18775758 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1105260870 13:18778608-18778630 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1105262257 13:18788473-18788495 GGCTTCTGCCTGGAAACAGTAGG - Intergenic
1105263181 13:18795199-18795221 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1106954726 13:34924005-34924027 GGCTCATGCCTTGGCACTGAGGG - Intergenic
1107081537 13:36380043-36380065 GACTGCTGCCATGGAAATGAAGG - Intergenic
1112849265 13:103684606-103684628 GGCTTCTTCCTCGGGACAGAGGG - Intergenic
1113627970 13:111860401-111860423 GGCTGCAGTCTGGGAACAGGAGG + Intergenic
1114071741 14:19115535-19115557 GGCTCATGCCTTGGCACTGAGGG - Intergenic
1114090519 14:19284429-19284451 GGCTCATGCCTTGGCACTGAGGG + Intergenic
1118709596 14:68508670-68508692 AGCTGCTGCCTTGGAGCAGTAGG - Intronic
1118867655 14:69716049-69716071 GGCAGATGTCTTGGAGCAGACGG + Intergenic
1122348156 14:101073122-101073144 GGCTCCTGCCTTGGAACGGGGGG - Intergenic
1202833829 14_GL000009v2_random:63058-63080 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1123474901 15:20582517-20582539 GGCTGCTGCCTGCACACAGAGGG + Intergenic
1123643110 15:22417840-22417862 GGCTGCTGCCTGCACACAGAGGG - Intergenic
1125921002 15:43525853-43525875 GGATACAGCCCTGGAACAGAAGG + Exonic
1127002883 15:54530786-54530808 GGCTGGTGCAATGAAACAGAAGG + Intronic
1127613653 15:60661656-60661678 TGCCTCTGCCTTGGAAAAGAGGG - Intronic
1129392746 15:75228778-75228800 GGGGGCTGCCCTGGGACAGAGGG - Intergenic
1130400354 15:83546684-83546706 GACTGCTGCCTGGCTACAGATGG + Intronic
1131398132 15:92103173-92103195 GGCTGCAGGCCTGGACCAGATGG - Intronic
1132201197 15:99955959-99955981 GGCAGCTGCCCTTGAAAAGATGG + Intergenic
1132349293 15:101128862-101128884 GCTTGCTGCCTTGGAGCTGACGG - Intergenic
1133169430 16:3972066-3972088 GGGGGCTGCCTCGCAACAGAAGG + Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1134185301 16:12080323-12080345 GGCTGCTGCGTGGGAACGGCTGG + Intronic
1134377680 16:13693120-13693142 GGCTGCTTTCTTAGAACAGTAGG + Intergenic
1137280008 16:46968469-46968491 GGCTTATGCCTCAGAACAGAAGG - Intronic
1137432186 16:48427339-48427361 GGATGGTGCCTTGGTACAGAGGG - Intronic
1137587831 16:49674732-49674754 CTCTGAGGCCTTGGAACAGATGG + Intronic
1138771578 16:59670889-59670911 AGCTGGTGCATTGGAACACAGGG + Intergenic
1140639054 16:76950523-76950545 TGCTGCTGACTTTGAACACAAGG + Intergenic
1141513800 16:84529559-84529581 GGCTGCTGTATGGGAATAGATGG + Intronic
1142642625 17:1293315-1293337 TGCTCCTGCTTTGTAACAGAGGG + Intronic
1143723987 17:8832982-8833004 GGTGGCCGCCTTGGAGCAGATGG - Exonic
1145007626 17:19346440-19346462 GGCTGCTGCCCTGGAACCCAGGG + Intronic
1145262922 17:21365390-21365412 GGCTGCTGCTCAGGGACAGAGGG + Intergenic
1147866351 17:43555231-43555253 GGATCCTGCCTGGGAAAAGACGG - Intronic
1148649135 17:49237145-49237167 GGCTGCTGCCTGTGCAGAGAAGG - Intergenic
1149486513 17:57046599-57046621 GGATCCTGCCCTGGAACAGGCGG - Intergenic
1150285056 17:63949750-63949772 GGCTGATGCCTGGGAAGGGACGG + Intronic
1151879640 17:76887394-76887416 GGCTGCTGAGTTGGAATAGCTGG - Intronic
1152215536 17:79029657-79029679 GCCTGCAGCCGTGAAACAGAAGG - Intronic
1153732008 18:8023221-8023243 GGCTGATGGCTGGGAAGAGATGG + Intronic
1154425145 18:14266183-14266205 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1154425526 18:14269059-14269081 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1154427863 18:14285584-14285606 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1154428258 18:14288645-14288667 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1154429184 18:14295240-14295262 GGCTTCTGCCTGGAAACAGTAGG + Intergenic
1154431458 18:14311585-14311607 GGCTTCTGCCTGGAAACAGTAGG + Intergenic
1154432837 18:14321423-14321445 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1154433224 18:14324300-14324322 GGCTTCTGCCTGGGAACAGTGGG + Intergenic
1154434137 18:14330889-14330911 GGCTACTGCCTGGAAACAGTGGG + Intergenic
1154434565 18:14333962-14333984 GGCTGCTGCCTGGAAACAGTGGG + Intergenic
1156309274 18:35907813-35907835 GGCTTCTGACTTGGGAAAGAAGG - Intergenic
1158470282 18:57729894-57729916 GCCTTCTGCCTTGAATCAGAAGG - Intronic
1160732576 19:647984-648006 GGGTCCTGCCCTGGAACAGGCGG + Exonic
1160920235 19:1516166-1516188 TGCTGGTGCCCAGGAACAGACGG - Intergenic
1160985739 19:1837726-1837748 GGGCGGTGCCTTGGAGCAGAGGG - Intronic
1161478281 19:4498233-4498255 GGCTCCTGCCCTTGAACAGCTGG + Intronic
1161808615 19:6459206-6459228 GGCGTCTGCCTGGGAAGAGATGG - Intronic
1162896683 19:13768706-13768728 GGCTGCTGCCATGGCCCATAGGG + Exonic
1164801312 19:31079096-31079118 GGCTGCTGGCTTGGACAAGAGGG + Intergenic
1165158594 19:33802929-33802951 GGCTGCTGCCTGAGAGCAGGAGG + Intronic
1165931587 19:39362656-39362678 TGATGCTGACTTGGACCAGAAGG + Intronic
1167145835 19:47680520-47680542 TGCTGCTGCCTTGGTTCAGGAGG - Exonic
1167553707 19:50179270-50179292 GGCTGCTCCCTTAGATCAGGTGG - Intergenic
1202638846 1_KI270706v1_random:64634-64656 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
925017883 2:545518-545540 CGCTGCTGCCGTGGAGCACACGG + Intergenic
925143749 2:1567674-1567696 GTCTGCTGCTTTGGAAGAGCTGG - Intergenic
926761899 2:16285460-16285482 GGGTGCTGCCTGGGAGGAGAGGG + Intergenic
927063029 2:19442130-19442152 GGCAGCTGCCTGGGAACTGCAGG - Intergenic
927738826 2:25548470-25548492 GGCTTCTTCCTAAGAACAGAAGG + Intronic
928213843 2:29344537-29344559 GTCTGCTGCCTTGAAAATGATGG - Intronic
928746099 2:34417816-34417838 TGCTGGTGCCTTAGCACAGATGG + Intergenic
931784827 2:65609232-65609254 GGCTGCTCTCAGGGAACAGAAGG - Intergenic
934491522 2:94764526-94764548 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
934492422 2:94770756-94770778 GGCTTCTGCCTAGAAACAGTGGG - Intergenic
934492557 2:94771631-94771653 GGCTTCTGCCTGGTAACAGTGGG - Intergenic
934494308 2:94784158-94784180 GGCTGCTGCTTGGAAACAGTGGG - Intergenic
934543658 2:95196670-95196692 GTCTGCTGCTTTGGTACTGAGGG - Intergenic
936589069 2:113785644-113785666 GCCAGCCACCTTGGAACAGAGGG - Intergenic
937243279 2:120476218-120476240 GGCTGCTGGCCTGGAGCTGAGGG - Intergenic
938012700 2:127841562-127841584 GGCTGCTGCCTGGGGACATCGGG + Intergenic
938279514 2:130054089-130054111 GGCTTCTGCCTGGAAACAGTAGG - Intergenic
938330461 2:130444799-130444821 GGCTTCTGCCTGGAAACAGTAGG - Intergenic
938359484 2:130676704-130676726 GGCTTCTGCCTGGAAACAGTAGG + Intergenic
938435883 2:131283353-131283375 GGCTTCTGCCTGGAAACAGTAGG + Intronic
938548090 2:132353139-132353161 GGCTGCTGCCTGCACACAGAAGG - Intergenic
943568774 2:189547333-189547355 GGCTGGGGACTTGGAAAAGAGGG + Intergenic
946250054 2:218406304-218406326 GGCCTCTGCCCTGGAGCAGAGGG + Intergenic
946996590 2:225399673-225399695 GGCTGCTGCTTGGGGAGAGAGGG - Intergenic
947755507 2:232561104-232561126 GAATACTGCCTTGGAAGAGATGG + Intronic
948788405 2:240364924-240364946 CGCTGCTGCCTTGGGGCGGAGGG + Intergenic
948983812 2:241508314-241508336 GGAAGCTGCCTTGGAAGAGGTGG - Intronic
1170719093 20:18859680-18859702 GGCTTCTGCCTTGGCACCCAGGG - Intergenic
1170866147 20:20160030-20160052 GGCTTCTGGCAGGGAACAGAAGG - Intronic
1171449729 20:25226943-25226965 GGCTGCTGGCCTGGCACAGGAGG - Intergenic
1171876959 20:30585911-30585933 GGCTGCTGCCTGCACACAGAAGG - Intergenic
1171883630 20:30635872-30635894 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1171885446 20:30648761-30648783 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1171968721 20:31549960-31549982 TGCTGCTGCCTGGGATCTGAGGG - Intronic
1172588394 20:36100915-36100937 GGCAGCTGCCTAGAACCAGATGG - Intronic
1172626531 20:36350600-36350622 ACCTGCTGCCCTGGTACAGAGGG - Intronic
1173863100 20:46297132-46297154 GGCTGGTACCCTGGGACAGAGGG + Intronic
1174445761 20:50590151-50590173 GGCTGCTGCCTTGGGCCAGAGGG + Intronic
1174447015 20:50597326-50597348 AGCTGGTTCCTTGGAGCAGAAGG + Intronic
1175226839 20:57449628-57449650 GGCTGCTGCCTTGGAAAGGGAGG - Intergenic
1176167019 20:63679665-63679687 GGCTGCAGCTTTGGAACTGAAGG - Intronic
1176842473 21:13851744-13851766 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1176844212 21:13864332-13864354 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1176845588 21:13874183-13874205 GGCTTCTGCCTGGAAACAGTAGG - Intergenic
1176846498 21:13880777-13880799 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1176846899 21:13883839-13883861 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1178362387 21:31959309-31959331 TGATGCTGACTTGGAAAAGAGGG + Intronic
1180363116 22:11917255-11917277 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1180490179 22:15837886-15837908 GGCTCATGCCTTGGCACTGAGGG - Intergenic
1181841104 22:25662290-25662312 GGCTGCTGCGTTGATACAGCAGG - Intronic
1182540906 22:31041220-31041242 GGCTGCTGCATTGGATCATGAGG + Intergenic
1183491779 22:38120690-38120712 GGCTGTTCCCTGGGGACAGAGGG - Intronic
1183608851 22:38883927-38883949 GACTCCTGCCCTGGAGCAGAGGG + Intergenic
1184314174 22:43670756-43670778 GACTGTTCACTTGGAACAGAAGG + Intronic
1184790044 22:46694698-46694720 GGCTCCTGCCTTGGAGCATGGGG + Intronic
949106931 3:210775-210797 GAGTGTTCCCTTGGAACAGAGGG - Intronic
950442529 3:13018410-13018432 GGCAGCTCACTTGGAACACATGG - Intronic
950470424 3:13181652-13181674 GGCTGGTGCCATGACACAGATGG + Intergenic
950471168 3:13187285-13187307 GGCTGATGCCATGATACAGATGG + Intergenic
952161784 3:30701083-30701105 GGGTCCTGCCATGGAACAGTAGG + Intergenic
952384921 3:32833475-32833497 GGCTGCTGCTGTTGCACAGAGGG + Intronic
954070003 3:48136042-48136064 GGCTCCTGGCTTGGAGCAAAGGG - Intergenic
954610930 3:51944160-51944182 GGTTGCTGTCTTGGAGCAGCTGG - Exonic
954645739 3:52130523-52130545 GGCTGCTGGCAGGGGACAGAGGG + Intronic
956452115 3:69385527-69385549 GGCTGTTGCTTTGCAACAGAGGG - Intronic
958948029 3:100386804-100386826 AGCTGCTGCCTTTGAACAGTTGG - Exonic
961599219 3:128046179-128046201 GGCTACTGCCATGGAACAAGGGG - Intergenic
961855289 3:129864454-129864476 GACTGATGCTGTGGAACAGATGG - Intronic
963108086 3:141663675-141663697 AGCTGGTGCTTTGGAACACAGGG + Intergenic
963358235 3:144237493-144237515 GCCTGGTGCCTGGAAACAGATGG - Intergenic
965378994 3:167964802-167964824 GGCTGATGACATGGAAAAGATGG - Intergenic
966288001 3:178320556-178320578 AGCTGCTGCATTCCAACAGAGGG - Intergenic
966455617 3:180112507-180112529 GACTGCTGACTTGTAACAGGAGG - Intergenic
968350472 3:198048289-198048311 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
968353520 3:198081397-198081419 GGCTGCTGCCTGCACACAGAAGG + Intergenic
969569582 4:8000753-8000775 GGCTGCTGCCTGGGAACGGGAGG + Intronic
970416059 4:15858087-15858109 GGCTACTGCCGTGGAGCAGATGG + Intergenic
970479824 4:16461576-16461598 GCCTGCTGCATTGGAACAGAAGG + Intergenic
970584393 4:17501366-17501388 AGCTGCTTCCCTGGAACACATGG + Intronic
972613141 4:40673601-40673623 AGTTGCTGCTTTGGAATAGAGGG - Intergenic
973367285 4:49218142-49218164 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
974026593 4:56738371-56738393 GGCTGCTGCCTTGCATAAGGTGG + Intergenic
975781322 4:77843294-77843316 GGCTGCATCTTTGGTACAGAGGG - Intergenic
976786087 4:88823250-88823272 AGCTGCTTCCCTGGAACAAAAGG - Intronic
977291451 4:95169281-95169303 GGCAGCTGTCTTGGAAGAAATGG - Exonic
977941197 4:102861184-102861206 CTCTGCTGCCTTGGAGGAGAAGG + Intronic
977969212 4:103193112-103193134 GGCTGGAGGGTTGGAACAGATGG + Intronic
979561129 4:122103317-122103339 GGCTGCTATCTTGGACCAAAAGG - Intergenic
981073853 4:140571696-140571718 GCCTGGTGCCTTGGTAAAGAGGG - Intergenic
983420600 4:167510472-167510494 GGTTGCTGCCTAGGAAAAAATGG - Intergenic
983456299 4:167968866-167968888 TGCACCTGCCCTGGAACAGAGGG + Intergenic
1202766193 4_GL000008v2_random:150493-150515 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
985865248 5:2509368-2509390 GGCTGCAGCTTTGGAGCTGAGGG - Intergenic
986500440 5:8393196-8393218 AGCTGCTGCTTTTGAAAAGAAGG + Intergenic
986536546 5:8793871-8793893 GGCTGGGGCCTTAGCACAGATGG - Intergenic
987116607 5:14731005-14731027 GGCTGCTGCCTTGGCCTCGAGGG - Intronic
988146348 5:27313643-27313665 TGCTGCTGCCTTGTAAAAAAGGG - Intergenic
988197795 5:28027945-28027967 GGACTCTGCCTTGGAACACAGGG + Intergenic
992106625 5:73453407-73453429 GGCTGCTGACCTGGAACAGGAGG - Intergenic
992203713 5:74409470-74409492 GGCTGGTGGCTTGGGCCAGATGG + Intergenic
994002090 5:94792340-94792362 TGCTTCTGCCTTTGGACAGATGG - Intronic
994671425 5:102766094-102766116 GGCTGCTGCCTTGTATCATATGG - Intronic
995425433 5:112016533-112016555 GGCTTCTGCCTTGGAAGAGCAGG + Intergenic
998144141 5:139716650-139716672 GGCTGCAGCATTGGAGAAGATGG - Intergenic
1000965698 5:167653646-167653668 GGCTGAAGGCTTGGAAGAGATGG - Intronic
1001242563 5:170081540-170081562 GTCCCCTGCCTTGGAGCAGAAGG + Intronic
1002107793 5:176888737-176888759 GGATGCTGCCTTGGCTCAGCAGG + Exonic
1002536316 5:179878193-179878215 GGCTCCTTCCTTGGGACACAAGG + Intronic
1003232829 6:4270162-4270184 ACCAGCTGCATTGGAACAGATGG + Intergenic
1003904891 6:10690153-10690175 GGCAGCAGCTGTGGAACAGAAGG + Intronic
1004640279 6:17508513-17508535 GGCTGGTGCCTAGGAACTAAGGG + Intronic
1005965086 6:30721389-30721411 GGCTGCTACGTTGTAGCAGAAGG + Intronic
1006729683 6:36227589-36227611 GGTTCCTGCCTTGGAACCCAGGG - Intronic
1011068472 6:83356242-83356264 GGCTTCTGTAATGGAACAGAGGG - Intronic
1011192091 6:84739844-84739866 GTGTGAAGCCTTGGAACAGATGG - Intronic
1013753224 6:113431289-113431311 TGGTGCTGCCTAGGAACAGTAGG - Intergenic
1015290322 6:131531741-131531763 GCCTGCTGCCTCTGAACAAAAGG - Intergenic
1015961120 6:138650266-138650288 GGCTGGAGCCTTGGAAGAGCTGG + Intronic
1016735743 6:147477945-147477967 GGCTGCTGGATGGGAACATATGG + Intergenic
1017824514 6:158071589-158071611 GGCTACGTCCCTGGAACAGAAGG - Exonic
1018350634 6:162955729-162955751 TGCTGCTGACTAGGATCAGAAGG - Intronic
1019213259 6:170423130-170423152 GGCTGCAGCCTCGGAATAGCCGG + Intergenic
1019365889 7:632580-632602 TGGGGCTGCCTTGGTACAGATGG + Intronic
1019519670 7:1454958-1454980 GGACCCTGCCTTGGAACTGAGGG + Intronic
1022115260 7:27255305-27255327 GGGTGCTCCATTGGATCAGAAGG - Intergenic
1026036447 7:66833316-66833338 GGCTCCTGGCTTGGCACAGTAGG + Intergenic
1026037518 7:66840229-66840251 GGCTCCTGGCTTGGCACAGTAGG + Intergenic
1026154603 7:67816159-67816181 CTCTGCTGCCTTCAAACAGATGG - Intergenic
1026610528 7:71855603-71855625 GGGTGCTGCCTAGGGTCAGACGG - Intronic
1029253131 7:99251034-99251056 GGCTGCTGCCTGGGAGCCCAGGG - Intergenic
1029955115 7:104630573-104630595 GTCTCCTGCCTTGGATCACATGG - Intronic
1030352301 7:108503620-108503642 GTCTGATGCCTTTAAACAGATGG - Intronic
1031725720 7:125235627-125235649 AGCTGCTGCCTTGAAGGAGATGG + Intergenic
1031849913 7:126851272-126851294 TGATGGTGACTTGGAACAGAGGG - Intronic
1033262803 7:139858181-139858203 GGCTGCTGCCTTGGAACAGATGG - Intronic
1035037598 7:155905506-155905528 GGCTGCTGTCTTTGAAGAGGAGG - Intergenic
1035105675 7:156440189-156440211 GGCTGCTCCCTGGGAATGGATGG + Intergenic
1037973660 8:23193090-23193112 GGGTGCTGCAGTGGAAGAGATGG - Intronic
1038017253 8:23525677-23525699 GGCTGCTGCCTTGTGACATCCGG + Intergenic
1038421572 8:27437248-27437270 GGCTTCAGCCTGGGAAGAGAGGG + Intronic
1040077011 8:43246812-43246834 GGCTGCTGCCTGCACACAGAGGG - Intergenic
1040998810 8:53429057-53429079 ATCTGCTGCCTTAGTACAGATGG - Intergenic
1041074712 8:54158947-54158969 CGCTGCTCCCTTTGCACAGAAGG - Intergenic
1049546495 8:143234113-143234135 AGCTGCTGTCATGGCACAGAGGG - Intergenic
1050168716 9:2793352-2793374 AGCTGCAGCCTTAGTACAGAAGG + Intronic
1050800798 9:9610550-9610572 GTATGCTACCTTGGAATAGATGG + Intronic
1052872614 9:33523561-33523583 GGCTGCTGCCTGCACACAGAGGG - Intergenic
1052877618 9:33579035-33579057 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1052878067 9:33582092-33582114 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1052878933 9:33588273-33588295 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1052879811 9:33594467-33594489 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1053143741 9:35698094-35698116 GGCTGCAGCCTTTGAAGAGCAGG - Exonic
1053496169 9:38549762-38549784 GGCTTCTGCCTGGAAACAGTGGG - Intronic
1053497041 9:38555946-38555968 GGCTTCTGCCTGGAAACAGTGGG - Intronic
1053498370 9:38565173-38565195 GGCTTCTGCCTGGAAACAGTGGG - Intronic
1053503515 9:38621310-38621332 GGCTGCTGCCTGCACACAGAAGG + Intergenic
1053662814 9:40296208-40296230 GGCTGCTGCCTGGAAACAGTGGG + Intronic
1053664201 9:40306044-40306066 GGCTGCTGCCTGGAAACAGTGGG + Intronic
1053665168 9:40312249-40312271 GGCTGCTGCCTGGAAACAGTGGG + Intronic
1053666480 9:40321342-40321364 GGCTTCTGCCTGGAAACAGTGGG + Intronic
1053752343 9:41269292-41269314 GGCTGCTGCCTGCACACAGAAGG + Intergenic
1053913261 9:42926383-42926405 GGCTGCTGCCTGGAAACAGTGGG + Intergenic
1053914747 9:42937296-42937318 GGCTGCTGCCTGGAAACAGTGGG + Intergenic
1053916065 9:42946388-42946410 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1054257870 9:62833624-62833646 GGCTGCTGCCTGCACACAGAAGG + Intergenic
1054374943 9:64442432-64442454 GGCTGCTGCCTGGAAACAGTGGG + Intergenic
1054376325 9:64452280-64452302 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1054377632 9:64461370-64461392 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1054518129 9:66054941-66054963 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1054519449 9:66064035-66064057 GGCTGCTGCCTGGAAACAGTGGG - Intergenic
1054520415 9:66070241-66070263 GGCTGCTGCCTGGAAACAGTGGG - Intergenic
1054521799 9:66080076-66080098 GGCTGCTGCCTGGAAACAGTGGG - Intergenic
1056585821 9:87926525-87926547 GGCTTCTGCCTGGCAACAGTGGG - Intergenic
1056586281 9:87929576-87929598 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1056610601 9:88123367-88123389 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1056611061 9:88126418-88126440 GGCTTCTGCCTGGCAACAGTGGG + Intergenic
1057152609 9:92808585-92808607 GGCTGCTGTCTGCGCACAGAAGG - Intergenic
1057675642 9:97134228-97134250 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1057676091 9:97137300-97137322 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1057677386 9:97146606-97146628 GGCTTCTGCCTGGAAACAGCAGG - Intergenic
1057677833 9:97149660-97149682 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1057684829 9:97222264-97222286 GGCTGCTGCCTGCACACAGAAGG + Intergenic
1058458510 9:105160638-105160660 GGCTGCTGTCCTGGAACAGGAGG - Intergenic
1060453786 9:123769960-123769982 GCCTGTTACCTAGGAACAGAGGG + Intronic
1060962617 9:127691693-127691715 GGATGATGCCTGGGGACAGAAGG - Exonic
1061386990 9:130296208-130296230 GGCTGCTGCCCTGGAAGAGTGGG + Intronic
1062028782 9:134352641-134352663 GGGTGCTGGCTTGACACAGAGGG + Intronic
1062131458 9:134896266-134896288 GTTTGCTACCTTGGGACAGATGG - Intergenic
1062370485 9:136236255-136236277 GGCTGCTGCCCAAGGACAGAGGG + Intronic
1062570153 9:137181230-137181252 GGCCCCTGCCCTGGCACAGATGG - Intronic
1203546941 Un_KI270743v1:135382-135404 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1185710824 X:2302249-2302271 GCCTGGTGACTTGGTACAGATGG - Intronic
1187115766 X:16348860-16348882 GGCTGCTTCTTTGCATCAGAAGG - Intergenic
1191219459 X:57971918-57971940 GGCTGCTGATTTGCCACAGAGGG + Intergenic
1191735537 X:64384662-64384684 GGCTCCAGCCTTGGCACAAAGGG - Intronic
1196296469 X:114003248-114003270 GTGTTCTGCCTTGGAATAGAGGG - Intergenic