ID: 1033262853

View in Genome Browser
Species Human (GRCh38)
Location 7:139858603-139858625
Sequence TCCGGGTACCAGGATGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033262853_1033262863 20 Left 1033262853 7:139858603-139858625 CCTGCAGCATCCTGGTACCCGGA 0: 1
1: 0
2: 0
3: 12
4: 219
Right 1033262863 7:139858646-139858668 CATGCTTGGTATCTGCTCTCTGG 0: 1
1: 0
2: 0
3: 21
4: 150
1033262853_1033262857 6 Left 1033262853 7:139858603-139858625 CCTGCAGCATCCTGGTACCCGGA 0: 1
1: 0
2: 0
3: 12
4: 219
Right 1033262857 7:139858632-139858654 CACTCCCCCAGCACCATGCTTGG 0: 1
1: 0
2: 4
3: 41
4: 697
1033262853_1033262864 26 Left 1033262853 7:139858603-139858625 CCTGCAGCATCCTGGTACCCGGA 0: 1
1: 0
2: 0
3: 12
4: 219
Right 1033262864 7:139858652-139858674 TGGTATCTGCTCTCTGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033262853 Original CRISPR TCCGGGTACCAGGATGCTGC AGG (reversed) Intronic
900885154 1:5409920-5409942 TCCTGGTCCCATGATGCTCCAGG + Intergenic
900949369 1:5849279-5849301 TCCTGCTCCCTGGATGCTGCTGG - Intergenic
903179882 1:21599781-21599803 TGCGGGTAGGAGGAGGCTGCAGG - Intronic
903479917 1:23645531-23645553 GCCAGGTACTAGGATGCTGCAGG + Intergenic
905212663 1:36385506-36385528 GCCGGGTACCGGGAGGCCGCGGG - Intronic
905229941 1:36508692-36508714 ACAGGCTACCAAGATGCTGCAGG - Intergenic
906558224 1:46732175-46732197 TTTGGGTATCAGGATGATGCTGG - Intergenic
906594350 1:47061687-47061709 TTTTGGTACCAGGATGATGCTGG - Intergenic
909518347 1:76538024-76538046 TCTTGGTATCAGGATGATGCTGG - Intronic
912792856 1:112670048-112670070 TGCGGGTAACTGGAAGCTGCCGG - Exonic
917305625 1:173621311-173621333 TTTGGGTATCAGGATGATGCTGG - Intronic
917663571 1:177201686-177201708 ACTGGGTATCAGGATGATGCTGG + Intronic
919231690 1:194781984-194782006 TTCTGGTATCAGGATGATGCTGG - Intergenic
922184618 1:223263229-223263251 TCCTGTTATCTGGATGCTGCTGG - Intronic
922397738 1:225219813-225219835 TTTTGGTACCAGGATGATGCTGG - Intronic
1064194357 10:13233435-13233457 GCCGGGCAGCAGGATGCAGCTGG - Intronic
1066160008 10:32718037-32718059 TTTTGGTATCAGGATGCTGCTGG - Intronic
1067484155 10:46630970-46630992 TGAGGGTACCAGGCTGCTCCAGG + Intergenic
1067610604 10:47710677-47710699 TGAGGGTACCAGGCTGCTCCAGG - Intergenic
1071059377 10:81551767-81551789 TTTGGGTATCAGGATGATGCTGG - Intergenic
1071491756 10:86140997-86141019 TCCAGGGACCAGGCTGCTGATGG - Intronic
1071626017 10:87170935-87170957 TGAGGGTACCAGGCTGCTCCAGG - Exonic
1072835179 10:98703437-98703459 TTCTGGTATCAGGATGATGCTGG - Intronic
1075705201 10:124496472-124496494 TCCGGCTAACGGGATGCGGCAGG + Intronic
1075899371 10:126027381-126027403 TGTTGGTACCAGGATGCTGTTGG - Intronic
1077828516 11:5837070-5837092 TTCCGGTATCAGGATGATGCTGG + Intronic
1078429435 11:11276997-11277019 TTTTGGTATCAGGATGCTGCTGG + Intronic
1079799509 11:24851602-24851624 TTTTGGTACCAGGATGATGCTGG + Intronic
1083433425 11:62626889-62626911 TCTGGGGACCATGATGCTTCTGG + Exonic
1084151646 11:67290298-67290320 TGCGGGCACCAGGCTGCTGAGGG - Intronic
1092332469 12:7597828-7597850 TTTTGGTACCAGGATGATGCTGG - Intergenic
1092581319 12:9845996-9846018 TCTTGGTATCAGGATGATGCTGG + Intergenic
1096570588 12:52520858-52520880 TCCAGGCAGCAGGTTGCTGCAGG + Intergenic
1097642693 12:62201726-62201748 TTCTGGTATCAGGATGATGCTGG + Intronic
1103210534 12:119162885-119162907 ACAGGGTCCCAGGATGCTGGAGG - Exonic
1104401796 12:128482461-128482483 TTTGGGTATCAGGATGATGCTGG + Intronic
1106406735 13:29481090-29481112 TCCAGGTGCCAGGATCCAGCAGG - Intronic
1109426910 13:62176948-62176970 TTTGGGTATCAGGATGATGCTGG - Intergenic
1114015050 14:18420769-18420791 ACAGGATTCCAGGATGCTGCTGG - Intergenic
1115943403 14:38633551-38633573 TACTGGTATCAGGATGATGCTGG - Intergenic
1116318217 14:43425517-43425539 TTTTGGTATCAGGATGCTGCTGG - Intergenic
1116320634 14:43457714-43457736 TTCTGGTATCAGGATGATGCTGG - Intergenic
1119422219 14:74514125-74514147 TCCAGGCACCAAGATGCTGGTGG - Intronic
1120726946 14:87954410-87954432 TGAGGGTACCAGGCTGCTCCAGG - Intronic
1122982501 14:105197980-105198002 GCCAGGTGCCAGGCTGCTGCGGG - Intergenic
1124092282 15:26617236-26617258 TCCTGGTATCAGGATGATGCTGG - Intronic
1126505821 15:49403252-49403274 TCTTGGTATCAGGATGATGCTGG + Intronic
1126760116 15:51962046-51962068 TCCAGCTACCAGGAGGCTGAGGG + Intronic
1126908188 15:53389788-53389810 TCTGGGTACCAGGACGGTACAGG - Intergenic
1128694844 15:69753745-69753767 TCCTTGTCTCAGGATGCTGCTGG + Intergenic
1129431961 15:75505626-75505648 GCTGGTTACCAGGATGCTTCTGG - Intronic
1129840579 15:78740924-78740946 GCTGGGTACCAGGATGTGGCGGG - Intergenic
1130317540 15:82809584-82809606 GCCGGGGGCCAGGGTGCTGCTGG + Intergenic
1132586766 16:708994-709016 CCCGGGTAACAGGGTGCTCCAGG - Intronic
1132586786 16:709073-709095 TCCAGGTAACAGGGTGCTCCAGG - Intronic
1132586790 16:709090-709112 TCCGGGTAACAGGGTGCTCCAGG - Intronic
1134309499 16:13062875-13062897 TCAGGGTACCAGGGTGAGGCTGG - Intronic
1134888578 16:17818033-17818055 CCCAGATAACAGGATGCTGCTGG + Intergenic
1136659527 16:31744609-31744631 TTTTGGTACCAGGATGATGCTGG + Intronic
1137921923 16:52498486-52498508 TGCTGGTACCAGGATCATGCGGG - Intronic
1138351458 16:56348273-56348295 TCCTGGGACCAGGATGGGGCAGG - Intronic
1138580994 16:57940311-57940333 CCCGGGTCACAGGGTGCTGCTGG - Exonic
1138883540 16:61047045-61047067 TTTGGGTATCAGGATGATGCTGG + Intergenic
1139331091 16:66190762-66190784 TCTGGGTCCTAGGATGCTGGTGG - Intergenic
1139349604 16:66326931-66326953 TCCGGCTCCCAGGATACTGGTGG - Intergenic
1142082133 16:88155065-88155087 CCCGGGCACCACAATGCTGCTGG + Intergenic
1143723076 17:8827269-8827291 TCCGGCTGCCTGGATGCTGCAGG + Exonic
1151201679 17:72472414-72472436 TCCAGGTGGCAGGATGCTACTGG + Intergenic
1151207396 17:72518028-72518050 TCCAGGTACCAGGCCACTGCTGG + Intergenic
1152180904 17:78821190-78821212 TTCGGACACCAGGATGCTTCAGG - Intronic
1152231035 17:79114325-79114347 CCTGGGTATCAGGATGCTGGGGG + Intronic
1152553906 17:81043560-81043582 CCCGGGTGCCAGGACGCTGTGGG - Intronic
1155764730 18:29614075-29614097 TCTTGGTATCAGGATGATGCTGG + Intergenic
1157066970 18:44363483-44363505 TTTTGGTACCAGGATGATGCTGG + Intergenic
1159040304 18:63318470-63318492 ACCGGGTCCCGGGATGCGGCTGG + Exonic
1160448942 18:78948872-78948894 GACGTGTAACAGGATGCTGCGGG - Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1163829219 19:19539883-19539905 TCCGGGGACCAGGACGGCGCCGG - Intronic
1164011040 19:21203640-21203662 ACTGTGTACCAGGAGGCTGCTGG - Intergenic
1164937229 19:32224152-32224174 CCCAGGTCCCAGGATGCAGCTGG + Intergenic
1165465729 19:35973830-35973852 TCAGGGTATCAGGTGGCTGCGGG - Intergenic
1166897597 19:46033582-46033604 TCCCGGTGCCAGCATGGTGCCGG - Intergenic
925601301 2:5611177-5611199 TCCAGGCCCCAGGAGGCTGCTGG + Intergenic
926747975 2:16175437-16175459 TCCGGTTGCCAGGACCCTGCTGG + Intergenic
928490892 2:31781873-31781895 TTCTGGTACCCGGATGATGCTGG - Intergenic
929901607 2:46008526-46008548 TCTGGGGACCAGGAAGCTCCTGG + Intronic
930818539 2:55622492-55622514 TGCGGGTACTAAGATGCAGCTGG - Intergenic
933132486 2:78689951-78689973 TTTTGGTACCAGGATGATGCTGG - Intergenic
933603507 2:84357468-84357490 TTTGGGTATCAGGATGATGCTGG - Intergenic
936139942 2:109930680-109930702 TTTGGGTATCAGGATGATGCTGG + Intergenic
936176631 2:110228625-110228647 TTTGGGTATCAGGATGATGCTGG + Intergenic
936204754 2:110440806-110440828 TTTGGGTATCAGGATGATGCTGG - Intronic
936611026 2:114002088-114002110 CCTGGGGACCAGGATGCTGATGG + Intergenic
937978329 2:127594959-127594981 TTTTGGTATCAGGATGCTGCTGG + Intronic
938217306 2:129530025-129530047 TCTTGGTATCAGGATGATGCTGG - Intergenic
938651205 2:133385533-133385555 CCTGGGTATCAGGATGATGCTGG + Intronic
939192561 2:138932983-138933005 TTTGGGTATCAGGATGATGCTGG - Intergenic
940933305 2:159462456-159462478 TGCGGGTAACCGGAAGCTGCCGG + Intronic
943227294 2:185194123-185194145 TTCTGGTACCAGGATGAAGCTGG - Intergenic
943262554 2:185684836-185684858 TCTTGGTATCAGGATGATGCTGG + Intergenic
943548968 2:189315084-189315106 TTTGGGTATCAGGATGATGCTGG - Intergenic
944163422 2:196691193-196691215 TTTTGGTATCAGGATGCTGCTGG + Intronic
944385430 2:199158459-199158481 TTTTGGTACCAGGATGATGCTGG - Intergenic
944922074 2:204425491-204425513 TCTTGGTATCAGGATGATGCTGG - Intergenic
946029660 2:216694264-216694286 CCCGGGTAGCAGGATCCTCCAGG + Intronic
947832832 2:233153871-233153893 CCCAGCTCCCAGGATGCTGCTGG + Intronic
947892124 2:233633296-233633318 TCCTGGTATCAGGATGATGCTGG + Intronic
949051037 2:241897432-241897454 GGCGGGGACCACGATGCTGCAGG - Intronic
1170074528 20:12405152-12405174 TCCAGGTAGCAGGCTACTGCAGG + Intergenic
1170730322 20:18969096-18969118 TTTTGGTACCAGGATGATGCTGG - Intergenic
1172568905 20:35953923-35953945 TTCCGCTACCAGGATGCGGCGGG - Exonic
1172809017 20:37633751-37633773 TCAGGGTACCAGGCTCCTTCTGG - Intergenic
1172934110 20:38607385-38607407 TCAGGGGACCAGGCTGCCGCTGG + Intronic
1175482975 20:59324469-59324491 TCCCGAGACCAGGATGCTGCAGG - Exonic
1175729844 20:61346789-61346811 TCCGGGGGCCAGGGTGCAGCAGG + Intronic
1176141068 20:63545337-63545359 TCCGGGTCCCAGGAAGCTCCAGG - Intronic
1177028412 21:15951668-15951690 TTTGGGTATCAGGATGATGCTGG + Intergenic
1177285158 21:19040273-19040295 TCCAGGTACAAGTTTGCTGCAGG - Intergenic
1179300655 21:40106456-40106478 TTTGGGTATCAGGATGATGCTGG + Intronic
1179987862 21:44931395-44931417 TCCGTGCCCCAGGATGCTACAGG - Intronic
1180439550 22:15351546-15351568 ACAGGATTCCAGGATGCTGCTGG - Intergenic
1180990576 22:19933388-19933410 TCCGGCTACCAGGCAGCTGGAGG - Intronic
1182860465 22:33555302-33555324 CCCAGGTACCAGGATACAGCTGG - Intronic
1182952302 22:34388840-34388862 TTTGGGTATCAGGATGATGCTGG + Intergenic
1183710881 22:39502538-39502560 TCAGGATACCAGCATGCAGCCGG + Intronic
1184333872 22:43841915-43841937 TCCAGGCACCAGCTTGCTGCAGG - Exonic
1185296750 22:50058419-50058441 TCCGGGTCCCGGGCTGCTGTCGG + Intergenic
950229829 3:11266727-11266749 TCCAGGTACCAGGATGGTTGAGG + Intergenic
950561643 3:13732881-13732903 TTTGGGTATCAGGATGATGCTGG + Intergenic
950712255 3:14820752-14820774 TCCGTGTACCAGGAGCCTGAGGG + Exonic
952574843 3:34762144-34762166 TTTTGGTACCAGGATGATGCTGG - Intergenic
956658974 3:71581604-71581626 GCCGGGGACCATGGTGCTGCCGG - Intronic
957908209 3:86584638-86584660 TTTGGGTATCAGGATGATGCTGG - Intergenic
958694236 3:97507647-97507669 TTTGGGTATCAGGATGATGCTGG + Intronic
959264084 3:104115811-104115833 TTTTGGTACCAGGATGATGCTGG - Intergenic
963312478 3:143723795-143723817 TCAGGTAACCAGGATGCTGCTGG - Intronic
963493516 3:146031083-146031105 TGCCGGTATCAGGATGATGCTGG + Intergenic
964339210 3:155690620-155690642 TCTGAGTATCAGGATACTGCTGG + Intronic
968436804 4:596248-596270 TTTGGGTATCAGGATGATGCTGG + Intergenic
970749439 4:19339772-19339794 TTTTGGTACCAGGATGATGCTGG + Intergenic
972726724 4:41751589-41751611 TCAGGGGACCTGGATGCTGACGG + Intergenic
974605105 4:64141911-64141933 TTTTGGTACCAGGATGATGCTGG + Intergenic
975986113 4:80202693-80202715 TCCGAGGACCAGGACGCTGGCGG + Exonic
976807082 4:89060252-89060274 TTTGGGTACCAGGATGATGCTGG + Intronic
978657180 4:111078209-111078231 TTTGGGTATCAGGATGATGCTGG - Intergenic
979219321 4:118203299-118203321 TTTGGGTACCAGGCTGATGCTGG + Intronic
980858697 4:138472403-138472425 TCTTGGTATCAGGATGATGCTGG + Intergenic
980865163 4:138545844-138545866 TTCTGGTATCAGGATGATGCTGG - Intergenic
981200004 4:141969347-141969369 TTTTGGTACCAGGATGATGCTGG - Intergenic
981290358 4:143068104-143068126 TTCTGGTATCAGGATGATGCTGG + Intergenic
981365224 4:143894659-143894681 CTCTGGTACCAGGATGATGCTGG - Intronic
983179778 4:164634101-164634123 TTTTGGTACCAGGATGATGCTGG - Intergenic
983972047 4:173887575-173887597 TTTGGGTATCAGGATGATGCTGG + Intergenic
984283502 4:177700985-177701007 TCTTGGTATCAGGATGATGCTGG + Intergenic
984794837 4:183649984-183650006 TCCGGGAACCAGGATGTTCTAGG - Intronic
985515829 5:344130-344152 TCCGGGCACCGGGGCGCTGCGGG - Intronic
986547419 5:8913755-8913777 TCTGGGCACGAGCATGCTGCAGG - Intergenic
986580870 5:9264587-9264609 TCGGGGTTCCAGGTTGCTGGGGG + Intronic
991507802 5:67343158-67343180 TCAGGGTACCAGGTTGGTTCAGG - Intergenic
991639653 5:68739682-68739704 TCAGGGTACCCTGATGCTGGTGG - Intergenic
992909050 5:81376994-81377016 TCTTGGTATCAGGATGATGCTGG - Intronic
992976100 5:82121975-82121997 TTTTGGTACCAGGATGATGCTGG + Intronic
993683777 5:90912714-90912736 TCCAGGAACACGGATGCTGCTGG - Intronic
996569301 5:124914834-124914856 GCCAGGTAACAGGATGATGCTGG - Intergenic
999347686 5:150838941-150838963 TCTGGGTACCAGCAAGCTTCTGG + Intergenic
1004156456 6:13172455-13172477 TCAGGTTACCAGGAGGCTGAAGG + Intronic
1004825936 6:19421360-19421382 TTTTGGTACCAGGATGATGCTGG + Intergenic
1005283037 6:24294972-24294994 TTTGGGTATCAGGATGATGCTGG - Intronic
1008470852 6:51882672-51882694 TCAGGGTACAAGGATGCAGATGG - Intronic
1009663040 6:66638277-66638299 TCCGGGATCCAGGCTGCTGGTGG + Intergenic
1011339890 6:86302535-86302557 TTTGGGTATCAGGATGATGCTGG + Intergenic
1011393758 6:86883411-86883433 TTTGGGTATCAGGATGATGCTGG + Intergenic
1012887248 6:104859804-104859826 TCCGGGGGCCGGGCTGCTGCCGG + Exonic
1013423497 6:109988527-109988549 TTTGGGTATCAGGATGATGCTGG + Intergenic
1014419936 6:121231091-121231113 TCCAGGTTCCTGGATGTTGCTGG + Intronic
1016847625 6:148584406-148584428 TTTTGGTATCAGGATGCTGCTGG + Intergenic
1017003016 6:150008831-150008853 TCCTGGTGCCAGGATGGTCCAGG + Intergenic
1017231916 6:152082117-152082139 TTTTGGTACCAGGATGATGCTGG - Intronic
1017310358 6:152968826-152968848 TTTTGGTACCAGGATGATGCTGG + Intergenic
1017390792 6:153937215-153937237 TTTTGGTACCAGGATGATGCTGG + Intergenic
1017615009 6:156237239-156237261 TTTGGGTATCAGGATGATGCTGG + Intergenic
1018578580 6:165286433-165286455 TTTTGGTACCAGGATGATGCGGG - Intronic
1019753740 7:2752006-2752028 TGTGGGTACCAGGATGATGCTGG - Intronic
1019930067 7:4217178-4217200 TCCGGGTGGCAGGGTGCTCCGGG - Intronic
1020487328 7:8735623-8735645 TTTTGGTACCAGGATGATGCTGG + Intronic
1020690608 7:11350185-11350207 TCTTGGTATCAGGATGATGCTGG + Intergenic
1021544208 7:21795010-21795032 TCTGAGTTCCAGGATGTTGCTGG + Intronic
1021750878 7:23798255-23798277 TTTTGGTACCAGGATGATGCCGG - Intronic
1026326398 7:69314366-69314388 TCCTGGTACCAGGAGGCTCCAGG - Intergenic
1027052495 7:75028925-75028947 TCCAGGCACCAGGCTGCTGGTGG + Intronic
1028140945 7:87274223-87274245 TCCAGGTAGCAGTCTGCTGCAGG - Intergenic
1029543997 7:101200873-101200895 TCCGGGTTCTGGGATCCTGCTGG - Exonic
1030448137 7:109673234-109673256 TTTTGGTACCAGGATGATGCTGG - Intergenic
1032682575 7:134200858-134200880 TCAGGGTATCAGGAAGCTGAGGG + Intronic
1033262853 7:139858603-139858625 TCCGGGTACCAGGATGCTGCAGG - Intronic
1033976805 7:147112872-147112894 TTTTGGTACCAGGATGATGCTGG + Intronic
1034260039 7:149749576-149749598 TCTGTGTGGCAGGATGCTGCTGG - Intergenic
1035379530 7:158428907-158428929 TCCCGGCACCAGGGTGCAGCTGG - Intronic
1036782230 8:11657724-11657746 TTCTGGTGCCAGAATGCTGCTGG - Intergenic
1037309356 8:17537841-17537863 TCCGGTTACCAAGGTGCTGAGGG + Intronic
1037841469 8:22248278-22248300 TGTGGGTACCAGGAGGCTGGGGG + Exonic
1038613074 8:29071582-29071604 TCCGGGCTCCAGGGTGGTGCCGG - Intronic
1040760469 8:50835890-50835912 TTTGGGTATCAGGATGATGCTGG - Intergenic
1041015695 8:53591292-53591314 GCCAGGGACCAGGAAGCTGCAGG - Intergenic
1043048453 8:75356327-75356349 TCCTGGTATCAGGATGATGCTGG + Intergenic
1053008247 9:34618612-34618634 GCCAGGTACCAGGAAGCTGAGGG + Intronic
1058402804 9:104636976-104636998 TCGAGGTACCAGGCTGGTGCAGG - Intergenic
1058908218 9:109498218-109498240 TCCGCGCCCCCGGATGCTGCAGG - Exonic
1061791164 9:133059907-133059929 TACAGCTACCACGATGCTGCAGG + Intergenic
1186679132 X:11853886-11853908 TTTGGGTATCAGGATGATGCTGG - Intergenic
1188009318 X:25040245-25040267 TCCGGGTTCAAGGATTCTCCTGG + Intergenic
1188628092 X:32313093-32313115 TTTTGGTATCAGGATGCTGCTGG - Intronic
1189557362 X:42159227-42159249 TTTTGGTACCAGGATGATGCTGG + Intergenic
1189820667 X:44867571-44867593 TCCTGGTACCAAGATGCAGTGGG + Intergenic
1189895760 X:45654500-45654522 TTTGGGTATCAGGATGATGCTGG + Intergenic
1189939123 X:46103091-46103113 TTTTGGTATCAGGATGCTGCTGG + Intergenic
1191132972 X:57034541-57034563 TTTGGGTATCAGGATGATGCTGG + Intergenic
1191749345 X:64524629-64524651 GCCAGGTATCAGGATGATGCTGG - Intergenic
1192067316 X:67899902-67899924 TTCAGGTATCAGGATGATGCTGG + Intergenic
1192625867 X:72728039-72728061 TGCGGGTAACTGGAAGCTGCCGG + Intergenic
1192879523 X:75268413-75268435 TTGTGGTACCAGGATGATGCTGG - Intergenic
1193359781 X:80567857-80567879 TTCTGGTATCAGGATGATGCTGG + Intergenic
1193389546 X:80910350-80910372 TTTTGGTACCAGGATGATGCTGG - Intergenic
1193780494 X:85695669-85695691 TTTGGGTATCAGGATGATGCTGG + Intergenic
1193879019 X:86898939-86898961 TTTGGGTATCAGGATGATGCTGG + Intergenic
1193899083 X:87153270-87153292 TTTCGGTATCAGGATGCTGCTGG + Intergenic
1194235351 X:91376502-91376524 TTTTGGTACCAGGATGATGCTGG - Intergenic
1194418786 X:93646910-93646932 TTTGGGTATCAGGATGATGCTGG + Intergenic
1195213870 X:102677231-102677253 TTTGGGTATCAGGATGATGCTGG + Intergenic
1196516137 X:116614444-116614466 TTTGGGTATCAGGATGATGCTGG - Intergenic
1199007630 X:142720913-142720935 TTTTGGTATCAGGATGCTGCTGG - Intergenic
1200093608 X:153647218-153647240 TCCGGCTGCCAGGAAGCGGCCGG + Exonic