ID: 1033267936

View in Genome Browser
Species Human (GRCh38)
Location 7:139902172-139902194
Sequence GGGGTTACACAGATCTACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033267936 Original CRISPR GGGGTTACACAGATCTACAA AGG (reversed) Intronic
900827283 1:4936935-4936957 GGGGAAACACAGCTGTACAATGG + Intergenic
901380966 1:8873886-8873908 GAGGTAACACAGAGCTACAAAGG + Intronic
902206055 1:14868958-14868980 TGGGGGACACAGATCAACAAGGG - Intronic
902274430 1:15329103-15329125 GGGGTTTCATAGACCTAAAAGGG + Intronic
908647111 1:66290175-66290197 AGAGTTGCACAGATCTAGAAGGG + Intronic
1064216396 10:13404201-13404223 GTATTTACACAAATCTACAAAGG + Intergenic
1069207313 10:65707093-65707115 GGGGTAAAATAGTTCTACAAGGG - Intergenic
1072377921 10:94836986-94837008 TGGGTTTCAAAGATCTTCAAAGG + Intronic
1076302846 10:129440961-129440983 GGGTTTACACAGATGCAAAATGG - Intergenic
1076366698 10:129925934-129925956 GGGATTCCACAGATCTTCACTGG - Intronic
1078846000 11:15119004-15119026 GGAGTTAGACAGATCTGGAAAGG - Intronic
1082704802 11:56480205-56480227 GGAGAAACACAGATCTAGAATGG + Intergenic
1082714725 11:56598141-56598163 GGTATAACAGAGATCTACAAAGG + Intergenic
1083299233 11:61731572-61731594 GGGATAACACAGAACTAGAAAGG - Intronic
1085703659 11:78767116-78767138 AGGGCTACAGGGATCTACAATGG + Intronic
1087857682 11:103111257-103111279 GGGTTTACAAAGATATAAAAAGG + Intronic
1090566916 11:128004746-128004768 GAGGATACAGAGATATACAAAGG + Intergenic
1098296136 12:69006033-69006055 TGGGTTACACAACTCTACCATGG - Intergenic
1098345946 12:69503584-69503606 GGTGATAGACAGATGTACAAAGG - Intronic
1104312172 12:127663404-127663426 GGGGTTCCATACATCTGCAATGG + Intergenic
1108679102 13:52764042-52764064 GGGTCTACAAAGATCTAGAAAGG - Intergenic
1121609624 14:95268583-95268605 GTGGTCACACAAATCTACATAGG + Intronic
1123680959 15:22763208-22763230 GGGGTTACACGAATCTATAGAGG - Intergenic
1124992646 15:34691207-34691229 GGGCTTACTCATAGCTACAAGGG + Intergenic
1133860891 16:9594238-9594260 GAGGTTACACAGCTTTCCAAAGG + Intergenic
1136692002 16:32039313-32039335 GGGGTCACAGAGAACCACAAGGG + Intergenic
1137532545 16:49289412-49289434 GAGGTTACACAGCTTAACAAAGG - Intergenic
1140421186 16:74820576-74820598 GGGGTGAAAGACATCTACAAGGG - Intergenic
1141299558 16:82801312-82801334 GAGGTTAGATAGATCTTCAAAGG - Intronic
1141752330 16:85967190-85967212 GGGGTTAGACACAGCTGCAATGG + Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1150624516 17:66833226-66833248 AGGGTCACACAGATCAAAAAGGG + Intergenic
1151091136 17:71441250-71441272 TGGTTTATACAGATCCACAAGGG + Intergenic
1164848502 19:31458057-31458079 AGGGATACACATATCTAAAAAGG - Intergenic
1165851662 19:38853140-38853162 GGGTTTACAAGGATCTGCAAGGG - Intergenic
1168179710 19:54652917-54652939 GGGGTTAACAAGAGCTACAAAGG + Intronic
945125582 2:206505974-206505996 TGGGTGACACAGATTTACATTGG + Intronic
945579618 2:211577034-211577056 GAGGTTACTCAGATATATAATGG + Intronic
1170165439 20:13357195-13357217 AGGCTTACAAAGATCTGCAAAGG + Intergenic
1170310854 20:14990004-14990026 GTGGTTACATAGCTCTAAAATGG + Intronic
1178171274 21:30042516-30042538 GGGGTTTCACAGCTCTCAAAAGG + Intergenic
1183000318 22:34851538-34851560 GTAGTTACACAAATCTACACAGG + Intergenic
950858337 3:16126073-16126095 GGGGCTAGACAGATCTAAGATGG + Intergenic
953005949 3:38979494-38979516 GGGATGACACAGATCTGCAAAGG - Intergenic
953467423 3:43135019-43135041 TGGGCTACACAGTTCTAGAAGGG + Intergenic
955873448 3:63464314-63464336 GGGGTTGCAGAGATGAACAAAGG + Intronic
956517911 3:70070372-70070394 GTGGTTACACAAATCTATACAGG - Intergenic
960334343 3:116397848-116397870 GGGGTTACACAGGTAACCAATGG - Intronic
971607206 4:28672968-28672990 GGCATGACAGAGATCTACAATGG + Intergenic
978794338 4:112694000-112694022 GTGGATACACGAATCTACAAAGG + Intergenic
983018443 4:162643809-162643831 GGGGATAGACAGAACTGCAATGG + Intergenic
985729657 5:1540105-1540127 GGGGTCACACAGAGCCACACAGG + Intergenic
990026305 5:51194697-51194719 GCTCTTACACAGATCTCCAACGG - Intergenic
1000735552 5:164894645-164894667 GGAGTTACAGAGATCAAAAATGG - Intergenic
1008670746 6:53766192-53766214 GGGGATCCACAGCTCTACAGGGG - Intergenic
1010112086 6:72249001-72249023 GGGGTTTCACAGAACCAGAATGG - Intronic
1019753802 7:2752915-2752937 GTGGTTACACAAATCTAGACAGG - Intronic
1030946306 7:115725934-115725956 GGGGTTACATAGACCAACATTGG + Intergenic
1033267936 7:139902172-139902194 GGGGTTACACAGATCTACAAAGG - Intronic
1035016698 7:155772838-155772860 GCGTTTACACAGAAATACAAAGG - Intronic
1038078722 8:24107564-24107586 GGGGTTGAATAGTTCTACAAAGG + Intergenic
1043946430 8:86259158-86259180 AGGGCTGCACAGATCTTCAAGGG - Intronic
1047676104 8:127204945-127204967 GTGGTTACACAGGTGTACACAGG + Intergenic
1051528649 9:18075720-18075742 GGGGTTACACAGCCCTCCCAGGG - Intergenic
1054937322 9:70701909-70701931 GGGATAACACAGATTTAAAAAGG + Intronic
1054939013 9:70719902-70719924 GGGATAACACAGATTTAAAAAGG + Intronic
1054963734 9:70998555-70998577 GGGTTTAGACAAATCTAGAATGG + Intronic
1059693558 9:116709299-116709321 GGGCTTCCACAGATATCCAAAGG - Intronic
1061461062 9:130739249-130739271 AAGGTAACACAGAGCTACAAAGG - Intronic
1062603383 9:137330453-137330475 GGAGCTACACAGGACTACAAAGG + Intronic
1185697067 X:2203229-2203251 CGGCTTACACATATATACAAAGG - Intergenic
1187073516 X:15911764-15911786 GGAGTCAGACAGATCTACGATGG - Intergenic
1188681492 X:33013552-33013574 GGTTTTACATAGATCTAAAATGG - Intronic
1189546300 X:42045832-42045854 GGGGTTTCCCAGATAAACAATGG - Intergenic
1192985773 X:76396937-76396959 TGGGTTACACAGAAAGACAATGG - Intergenic
1195527224 X:105905256-105905278 AAGGTTACACAGAGCTGCAAAGG - Exonic
1198772149 X:140141859-140141881 AGGGTTGCACAGATCTATATAGG - Intergenic