ID: 1033270670

View in Genome Browser
Species Human (GRCh38)
Location 7:139930188-139930210
Sequence TAAATTGGTCAGTTGGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033270670 Original CRISPR TAAATTGGTCAGTTGGCACT GGG (reversed) Intronic
901031560 1:6310167-6310189 AAAATCTGTCAGTTGCCACTTGG + Intronic
906531583 1:46526799-46526821 TAAGTTGGTCAGTGTGCCCTGGG + Intergenic
910184328 1:84520398-84520420 TAAGTTGGCCACTTGGCACTTGG - Intergenic
911068307 1:93811825-93811847 AAAATATGTCAGTTGGCTCTTGG - Intronic
912370461 1:109170210-109170232 GAAATTAGTCACTTGGCAGTGGG + Intronic
915663835 1:157426435-157426457 TTAATTGGGCATTTAGCACTGGG - Intergenic
922865889 1:228861290-228861312 TAAATCAGTCAGTAAGCACTGGG + Intergenic
923236535 1:232039157-232039179 TGAACTGGTCACATGGCACTTGG + Intronic
923483519 1:234406916-234406938 TGAATTGGTCAGTAGAAACTGGG - Intronic
924104115 1:240633635-240633657 TGAATAGGTCAATTGGCATTTGG - Intergenic
924907017 1:248466198-248466220 TAAATCTGTCAGATGGTACTCGG + Intergenic
1063758096 10:9039183-9039205 GAAATTGGCCACTGGGCACTGGG + Intergenic
1066439073 10:35420603-35420625 TGAATTGGTCATTGGGAACTGGG - Intronic
1075977832 10:126711858-126711880 TATATTTATTAGTTGGCACTTGG - Intergenic
1083465039 11:62839756-62839778 TACATTGATCATTTTGCACTTGG + Exonic
1088733576 11:112706378-112706400 TAAATTGGTCTGTTGGATTTGGG + Intergenic
1090457366 11:126861568-126861590 TATATTGGTCATTTGCCAGTTGG - Intronic
1091575149 12:1726788-1726810 AGAAATGTTCAGTTGGCACTAGG - Intronic
1094391906 12:29960808-29960830 AAGAGTGTTCAGTTGGCACTGGG - Intergenic
1097324376 12:58259302-58259324 CATATTGGTCAGTTTGGACTTGG + Intergenic
1098516519 12:71383256-71383278 TAAACTGGTAAGTTGGAACTCGG + Intronic
1099506344 12:83481153-83481175 TAAATCTGTCAGTTGTCATTTGG - Intergenic
1101664988 12:106804552-106804574 TAAATTGGTCAGGTGGCAGCTGG + Intronic
1105540336 13:21310860-21310882 TAACTTGGTTACTTGGCATTTGG + Intergenic
1106793514 13:33180838-33180860 TAAATTTTCCATTTGGCACTAGG - Intronic
1108402727 13:50063687-50063709 TAAATTGCTCTTTTGGCAGTTGG - Intergenic
1108664086 13:52611695-52611717 TAAATTGTTCAGTGTGCAGTGGG + Intergenic
1110514827 13:76397679-76397701 TCAAAAGGTCAGATGGCACTGGG + Intergenic
1110648087 13:77912347-77912369 CAAAATGGTCAGTAAGCACTTGG - Intronic
1111234431 13:85390233-85390255 TAAATTGTTCAAATGGCACACGG + Intergenic
1111612548 13:90622404-90622426 TAAATGGGTCAGGTGTCACCTGG + Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1115165388 14:30442830-30442852 TAAATTAGGCAGTGGGCTCTTGG - Intergenic
1118678168 14:68211226-68211248 TAAATCAGTCACTAGGCACTGGG - Intronic
1118816380 14:69317190-69317212 TAAATGCATCATTTGGCACTTGG - Intronic
1122173166 14:99893709-99893731 TAAACTGGGCAGTTGGAACCAGG - Intronic
1131714443 15:95093033-95093055 CAAATTGGACACTTGGCACTGGG + Intergenic
1136016422 16:27403829-27403851 CAACATGGTGAGTTGGCACTGGG - Intronic
1144101678 17:11947268-11947290 TAAATTGGCCATTGGGCATTTGG - Intronic
1146066769 17:29642195-29642217 CACATTGGTCAGCTGGCAGTAGG - Intronic
1149573773 17:57696773-57696795 GCATTTGGTCAGTGGGCACTGGG + Intergenic
1150726760 17:67657409-67657431 TTAATTGCTTATTTGGCACTGGG + Intronic
1153140861 18:1971141-1971163 TAAAGTGGTCAGTCAGCACAAGG + Intergenic
1153653938 18:7265465-7265487 TTAATTGCTTAGTTGGCTCTAGG - Intergenic
1157088035 18:44602604-44602626 TAACTTGGTTACTTGGCATTTGG - Intergenic
1158144359 18:54294884-54294906 TTAATAGGTTAGTTGGCAGTAGG - Exonic
1163893954 19:20040842-20040864 TTAATTGGTCTGTTGCAACTTGG - Intergenic
1165903543 19:39179759-39179781 CAAATTGGTCAGTGGGCAGATGG + Intronic
927126230 2:20014048-20014070 TAAATTGGTGAGTTCTCAGTGGG - Intergenic
928188316 2:29136460-29136482 TATATTGGTTATTGGGCACTGGG + Intronic
935549125 2:104433030-104433052 TAAATTGGTAATTTTGCATTAGG - Intergenic
935650807 2:105380339-105380361 GAAAAGGGTCACTTGGCACTAGG - Intronic
937819737 2:126296156-126296178 TAAAATGGTCAGTGGATACTGGG + Intergenic
941141944 2:161794600-161794622 TAAATTGATCAGTTCACATTGGG + Intronic
943659896 2:190548017-190548039 TAACTAGGTCACTTGCCACTTGG + Intergenic
944270154 2:197773891-197773913 CAAAGTGGTTAGTTGGGACTCGG + Intronic
945556465 2:211282172-211282194 AAAGTTGGTCAATTGGCACAAGG + Intergenic
1170341210 20:15329368-15329390 TACATTGCTCATCTGGCACTTGG + Intronic
1176176815 20:63731381-63731403 TAAAGTGTACAGTTGGCCCTTGG + Intronic
1176176826 20:63731538-63731560 TAAAGTGTACAGTTGGCCCTTGG + Intronic
1176176830 20:63731591-63731613 TAAAGTGTACAGTTGGCCCTTGG + Intronic
1176176840 20:63731738-63731760 TAAAGTGTACAGTTGGCCCTTGG + Intronic
1184918009 22:47586445-47586467 TAATGGGGTCATTTGGCACTGGG - Intergenic
949397226 3:3627607-3627629 TAAATGTGTAAGTTGGAACTGGG - Intergenic
951046472 3:18044835-18044857 TAAATTGTGCAGTTGGAATTTGG + Intronic
951190283 3:19760993-19761015 TAAATTTGTCATTTGGAACTTGG - Intergenic
958143957 3:89600175-89600197 TCAATTGTTCAGTTGGGGCTTGG + Intergenic
962596211 3:136946754-136946776 TAAATTGGTTACTTGGAAATTGG + Intronic
963812909 3:149797228-149797250 TAAAATGGTCAGTTTTCCCTGGG - Intronic
964709478 3:159656478-159656500 TAGATTAGTCAGTTGCCACCTGG - Intronic
966645534 3:182242492-182242514 TAAATGGGGGAGCTGGCACTTGG + Intergenic
972111573 4:35567521-35567543 TAAATTTGTCAATTGAAACTCGG - Intergenic
972213669 4:36869965-36869987 TAAATGGGTGAGTTTGCATTAGG + Intergenic
972337630 4:38121908-38121930 TAAATTTGTCTGATGACACTTGG - Intronic
972877678 4:43384301-43384323 GAAATTGCTCAGTTTTCACTTGG - Intergenic
972921213 4:43944344-43944366 TAAATTGGACTGTTTGCATTTGG - Intergenic
973154055 4:46926354-46926376 TAAATTGGGGGGTTGGGACTGGG + Exonic
973756875 4:54083559-54083581 CAAATGGGTCAGTGGGGACTTGG - Intronic
977988418 4:103413404-103413426 TAAATTAATCAGGTGCCACTTGG - Intergenic
978160647 4:105543558-105543580 TAACTAGGTCAGTTTGCACTTGG - Intergenic
980307846 4:131087523-131087545 TAAATAGATCAGCTGGGACTTGG + Intergenic
981171125 4:141624470-141624492 TAAGTTGCTGAGTTGGGACTTGG - Intergenic
992019497 5:72607846-72607868 TAAATGTGTCAGTTGGGGCTAGG - Intergenic
993759726 5:91778749-91778771 TGGATTGGTTAGTGGGCACTGGG + Intergenic
995932303 5:117461527-117461549 TAAATTGGTTAGTGTGCACCTGG - Intergenic
996524256 5:124461129-124461151 CAAAAGGGTCAGTTGGCACTTGG - Intergenic
998617193 5:143753248-143753270 CAAATGGGTCAGTAGGCAGTGGG - Intergenic
999207633 5:149861263-149861285 TAAAGGGGGCAGTTGCCACTCGG + Intronic
1001950165 5:175810840-175810862 TAAACTGGTCAGGTGGAATTTGG + Intronic
1002966494 6:1971177-1971199 TAGTTTGTTCAGTGGGCACTGGG + Intronic
1005587124 6:27287855-27287877 CAAATTGTTCAGTTGCCATTTGG - Intronic
1006531876 6:34662489-34662511 TTCATTGGTCAGTGGACACTTGG - Intronic
1008431241 6:51419995-51420017 TAAATTGGTCAGAGAGCAATAGG - Intergenic
1009718915 6:67438892-67438914 TAAAATGTTAAGTTGGAACTGGG - Intergenic
1011194549 6:84767591-84767613 TAAATGTGTCTGTTGGCAGTTGG + Intergenic
1016816508 6:148307804-148307826 TTAATTGGTCACTTGGCTCAGGG + Intronic
1018725823 6:166612766-166612788 TAAATTTGGCAGTGGCCACTTGG - Intronic
1021783068 7:24125133-24125155 TAATTTTATCAATTGGCACTTGG + Intergenic
1023122003 7:36919002-36919024 TCAGTCAGTCAGTTGGCACTTGG + Intronic
1024894060 7:54236765-54236787 CTTATTGGTCAGTGGGCACTTGG - Intergenic
1028992888 7:97068757-97068779 AAAAATAGTCATTTGGCACTTGG + Intergenic
1030989379 7:116281667-116281689 TACAATGGGCAGTAGGCACTTGG - Intergenic
1033265454 7:139882371-139882393 TAAATTGGGCAGCTGACACCTGG + Intronic
1033270670 7:139930188-139930210 TAAATTGGTCAGTTGGCACTGGG - Intronic
1037842400 8:22254623-22254645 TGAATTGGGCAGTCAGCACTAGG + Intergenic
1038086238 8:24199701-24199723 TAAATTAGACAGTTGGTAGTGGG + Intergenic
1038172026 8:25144195-25144217 TACATTATTTAGTTGGCACTGGG + Intergenic
1042329818 8:67567036-67567058 AAAATTTATCAGTTGGCACTTGG + Intronic
1044046197 8:87435922-87435944 TAAATTAGATAGTTGGCACTAGG - Intronic
1044558243 8:93588000-93588022 TCAAGTGGTCAGCTGGGACTTGG - Intergenic
1046261745 8:111777482-111777504 GAAATTGGTCAGTGGGTACAAGG - Intergenic
1050035094 9:1426746-1426768 TACATTGATCAGTTGGGACATGG + Intergenic
1051415275 9:16833194-16833216 TGAATAGGTCAGTTGTCACTTGG - Intronic
1052191396 9:25667627-25667649 GAAAATGGTCTTTTGGCACTGGG + Intergenic
1053666515 9:40321559-40321581 TGAACTAGTCAGTTGGGACTTGG + Intronic
1053916099 9:42946605-42946627 TGAACTAGTCAGTTGGGACTTGG + Intergenic
1054377667 9:64461587-64461609 TGAACTAGTCAGTTGGGACTTGG + Intergenic
1054518094 9:66054724-66054746 TGAACTAGTCAGTTGGGACTTGG - Intergenic
1055351725 9:75395728-75395750 TAATTTGGTCAGTTGGCCAAAGG - Intergenic
1055951864 9:81736930-81736952 TAGATTGGTCTGTTTGCAATAGG + Intergenic
1056258477 9:84824444-84824466 CAAATTGGTATGTTGGCCCTGGG + Intronic
1058207210 9:102123487-102123509 AAAATTGGTGGTTTGGCACTTGG - Intergenic
1059670734 9:116489708-116489730 TGAATTGGCCAGATGGCCCTGGG + Intronic
1185842111 X:3401517-3401539 TAATTTGGTCAGCTGGGCCTTGG + Intergenic
1187678615 X:21743335-21743357 TAGATTGGTAAGTTTTCACTTGG - Intronic
1191075529 X:56449497-56449519 TTAATTCGTCATTTGGCATTAGG + Intergenic
1191874096 X:65776730-65776752 TAATTTGGTCAAATGTCACTTGG + Intergenic
1198013702 X:132587166-132587188 TAAATTGGACAGGGGGCACTTGG - Intergenic
1198443873 X:136691906-136691928 TAAGTAGGTCACTTTGCACTAGG - Intronic
1199091237 X:143695307-143695329 GAAAATAGTCAGTTGCCACTTGG + Intergenic
1201635902 Y:16122953-16122975 TAATTTGGTCTGTTGGGACCTGG - Intergenic