ID: 1033271971

View in Genome Browser
Species Human (GRCh38)
Location 7:139940153-139940175
Sequence CTTTGCATATGAAGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033271965_1033271971 -1 Left 1033271965 7:139940131-139940153 CCTAATTCCAAAAGCAGCTCCCC 0: 1
1: 0
2: 0
3: 16
4: 182
Right 1033271971 7:139940153-139940175 CTTTGCATATGAAGAGCAGAGGG 0: 1
1: 0
2: 1
3: 28
4: 248
1033271966_1033271971 -8 Left 1033271966 7:139940138-139940160 CCAAAAGCAGCTCCCCTTTGCAT 0: 1
1: 0
2: 0
3: 18
4: 183
Right 1033271971 7:139940153-139940175 CTTTGCATATGAAGAGCAGAGGG 0: 1
1: 0
2: 1
3: 28
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033271971 Original CRISPR CTTTGCATATGAAGAGCAGA GGG Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
903111464 1:21138147-21138169 CTTTGCATAAGAAACACAGAGGG + Intronic
903573073 1:24320689-24320711 CTGTGAACATGAAGAGCTGAAGG - Intronic
905800616 1:40839984-40840006 CTTTGCAGAAGAGGAGCAAAGGG - Exonic
908590271 1:65624090-65624112 CTTTGCACATAAAGAACAGCAGG - Intronic
909979938 1:82086777-82086799 CATGGCATATCAAGAGCACAGGG - Intergenic
910535404 1:88292119-88292141 CAGAGCATATGAAGAGCTGAAGG - Intergenic
911903603 1:103536919-103536941 CTTTCCAAAAGTAGAGCAGAGGG + Intronic
912123035 1:106497020-106497042 CTTTTGATATGCATAGCAGATGG + Intergenic
914786097 1:150832589-150832611 GTTTGCATATGAAGAACATATGG - Intronic
915865950 1:159499575-159499597 ATTTTCATAGGAAGAACAGATGG - Intergenic
916395995 1:164387868-164387890 CTTTGGAGATGAAGAGCTCAAGG - Intergenic
916688047 1:167165605-167165627 CTTAGCAAATGAAGAGAAAAAGG + Intergenic
916962051 1:169898372-169898394 CTATGCATAAGAAAGGCAGAAGG - Intergenic
917588497 1:176452809-176452831 CATTGAATATGAAGAGCCCATGG + Intergenic
917890291 1:179430923-179430945 CTCTGCATATGATTTGCAGATGG - Intronic
918147487 1:181770334-181770356 CTTTTCATCTGAAGAGTGGAGGG + Intronic
919037336 1:192330900-192330922 CTTTGAATTTGATGAGCTGAGGG + Intronic
919420795 1:197367801-197367823 CTTTCCATACAGAGAGCAGATGG - Intronic
919593430 1:199532443-199532465 CTTTACAAATGAACAGCACAGGG - Intergenic
920360824 1:205414996-205415018 CTTTGTATGTGAAGAGCTGCAGG + Intronic
920574225 1:207045410-207045432 CTTTGATTAAGAAGAGCTGATGG + Exonic
921117049 1:212101919-212101941 GTTTGCATGTGAAGGGGAGATGG + Intronic
922424462 1:225480490-225480512 CTTTGCAGATGAAGAGTAGTGGG + Intergenic
923540401 1:234884584-234884606 CTTGGCACATGCAGAGGAGAGGG + Intergenic
924336120 1:242988419-242988441 CTTTGCATATGAAGAGGGTGAGG - Intergenic
924350764 1:243112583-243112605 CTTTTTATGTTAAGAGCAGAAGG + Intergenic
924690216 1:246341742-246341764 CTTTGTATGTAAAGAGGAGAGGG - Intronic
1063006830 10:1979691-1979713 CTTTGCTTATGAAAATCTGAAGG - Intergenic
1063402876 10:5764498-5764520 CTTTGCATGGGAAGAGAAAAAGG + Intergenic
1064298307 10:14098968-14098990 GTTTTCAGATGAAGAACAGAAGG - Intronic
1065449041 10:25836595-25836617 TTTGGCATATGAACAGCTGAGGG + Intergenic
1067957133 10:50804422-50804444 CTTTGCAAATAAACAGCAAAGGG - Exonic
1068350424 10:55837334-55837356 GTTTGGATATTAAAAGCAGAGGG + Intergenic
1068844809 10:61659661-61659683 AGTTTCATCTGAAGAGCAGAAGG + Intergenic
1069615706 10:69804940-69804962 ATTTTCAAATGAAGAGCTGAAGG + Intronic
1070395569 10:76008932-76008954 TTTTGCAGATGAAGAGCCTATGG + Intronic
1070640423 10:78164944-78164966 CTGTCCATATGGACAGCAGAAGG - Intergenic
1071003319 10:80855546-80855568 CCTGGCAGATGAACAGCAGATGG + Intergenic
1071262617 10:83934429-83934451 CTTTCTTTATGAAGAGCAGAGGG - Intergenic
1072354637 10:94595347-94595369 ATATGTAGATGAAGAGCAGATGG + Intronic
1073900792 10:108218008-108218030 CTTTGCAGGAGAAGAGCAGAGGG + Intergenic
1074968989 10:118520200-118520222 CTTGGCATTTAAATAGCAGAGGG + Intergenic
1075167698 10:120084150-120084172 CTTTTCATATGTATAGCAGACGG + Intergenic
1076275879 10:129197984-129198006 CATTTCGTATGAAGAGCAGAGGG + Intergenic
1077015602 11:397802-397824 CTCAGCAGAGGAAGAGCAGAAGG + Intronic
1077427487 11:2490180-2490202 CTTTGCCTATGGAAAGGAGAAGG + Intronic
1080175090 11:29353819-29353841 CTTTTAAGATGAAAAGCAGATGG + Intergenic
1080763389 11:35273959-35273981 CTTTACAGATGAAAAGGAGAGGG + Intronic
1081728922 11:45354921-45354943 ATTAGCATATGATGAGCAGTGGG + Intergenic
1082131459 11:48494869-48494891 CTGTGTATTTGAAGAGCAGATGG + Intergenic
1087492933 11:98850580-98850602 ATTAGTGTATGAAGAGCAGAAGG + Intergenic
1088046492 11:105458091-105458113 CTTTGCATGAGAAAAGGAGAGGG + Intergenic
1088226178 11:107622686-107622708 CATTGCTTTTGAAGAGCAGAAGG + Intronic
1088929761 11:114339837-114339859 CCTTGCATATGGGGAGCAGAGGG + Intergenic
1090279464 11:125443669-125443691 CTTTGAATAGGAAGAACACAGGG + Intergenic
1091684638 12:2552990-2553012 CATTGCTTCTGAAGAGGAGAAGG + Intronic
1092317335 12:7431650-7431672 CTATGCATATGACGAGTTGATGG + Intronic
1093477914 12:19574976-19574998 CCTTGCATTTGAAGAGAAGAGGG - Intronic
1094551413 12:31455248-31455270 CTTTTCATAGGAGGAGGAGAGGG - Intronic
1094923810 12:35486014-35486036 CTTTCCTTTAGAAGAGCAGATGG + Intergenic
1094937973 12:35715414-35715436 CTTTCCTTTAGAAGAGCAGATGG + Intergenic
1095001406 12:36741160-36741182 CTTTCCTTTAGAAGAGCAGATGG + Intergenic
1095099523 12:38165973-38165995 CTTTGCTTGGGAAAAGCAGAGGG - Intergenic
1095375759 12:41526434-41526456 CTTGGAAAATGAAAAGCAGAAGG - Intronic
1095550748 12:43436119-43436141 TTTTGAATATGAAAAGTAGATGG + Intronic
1095726747 12:45462234-45462256 CTTTCCACATGAAGCACAGAGGG - Intergenic
1099034554 12:77569593-77569615 CTTGGCAAATGAGGAGTAGAAGG - Intergenic
1107109004 13:36675288-36675310 CTTTGCACCTGTAGTGCAGACGG - Intronic
1107210919 13:37852872-37852894 CTTTGCCTGTGAAAAGGAGAAGG + Intronic
1109148394 13:58812458-58812480 CTTCACATGTGAAGGGCAGAAGG - Intergenic
1109307079 13:60652712-60652734 CTTTGCTTATTAAAAGCAAACGG - Intergenic
1110550937 13:76810870-76810892 CTTTTCATATAATGAACAGAGGG - Intergenic
1113591727 13:111506237-111506259 CTTTGCATCTGGAGAGCTGAAGG + Intergenic
1114759092 14:25291546-25291568 CTTTCCATATGAAAATCAGATGG + Intergenic
1116391153 14:44391447-44391469 CTTTGCACATGATGACCAGGAGG - Intergenic
1118709188 14:68505893-68505915 CTTTGCATATGTACTGCTGAGGG + Intronic
1119066713 14:71535503-71535525 CTTTCCATCAGAGGAGCAGAAGG - Intronic
1121798538 14:96754987-96755009 CTAAGCAGATGCAGAGCAGATGG + Intergenic
1122882940 14:104698146-104698168 CTTTCCAGATGGAGAGCAGAGGG + Intronic
1127146739 15:56032743-56032765 CTTTCCATTTGAAGGGCAGTGGG + Intergenic
1128103122 15:65022039-65022061 ATTTGTATATGAAAAGCATAAGG + Intronic
1128408785 15:67371572-67371594 CTCTGGATATTAAGAGAAGATGG + Intronic
1128607361 15:69047028-69047050 CCTTGGATATAAAGAGCAGGGGG - Intronic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1131676259 15:94673733-94673755 CTTTGCACATGATGTGCAGGTGG + Intergenic
1132552256 16:558382-558404 GTTTGCATGAGAAGAGAAGAGGG - Intergenic
1133172927 16:3992864-3992886 TTTGGCAGATGGAGAGCAGATGG + Intronic
1133858331 16:9570855-9570877 GTTTGCATCTGATGAGCAAATGG + Intergenic
1138215805 16:55204354-55204376 CTTTTTATGTGAAGGGCAGAGGG - Intergenic
1139141120 16:64263884-64263906 CTTTACATATGAATAGCTCAGGG - Intergenic
1140636967 16:76926241-76926263 CTTTTCATCTGAAGAGCAGTGGG - Intergenic
1144213819 17:13037157-13037179 CACTGGAGATGAAGAGCAGATGG + Intergenic
1147497847 17:40935011-40935033 TTTTGCAAATGGAGAGCAAAGGG - Intronic
1147780522 17:42937922-42937944 CTTTGCAATTTAACAGCAGAGGG - Intergenic
1148545454 17:48515384-48515406 CTTTACATATGAAGAGCCCAAGG - Intergenic
1149586865 17:57794960-57794982 CTTTAAATATGAAGAACAAACGG + Intergenic
1149964190 17:61145517-61145539 CTTTGGAGATGAAAAACAGACGG + Intronic
1150177975 17:63082383-63082405 TGTTTCATATGAAGAGCAGTTGG + Intronic
1152534390 17:80942000-80942022 CTGTGCATCTGAAGAGCTGGCGG + Intronic
1154050676 18:10953849-10953871 CTTTGAATATCAACAGCACAGGG + Intronic
1155169285 18:23255179-23255201 GTTTGCATTTGAAGAGCAAAAGG + Intronic
1156388513 18:36628294-36628316 CTTTGGATATTAAGAGCCAAGGG - Intronic
1156520785 18:37720935-37720957 GATTGGGTATGAAGAGCAGAGGG - Intergenic
1162695451 19:12470236-12470258 CTTTGCATATGGACATCAGTAGG - Intronic
1163996565 19:21054311-21054333 CTTTTTATATGTAGAGCATACGG + Intronic
1164404546 19:27932356-27932378 CTTGGTAGATGAAGAGAAGAAGG - Intergenic
1165675125 19:37716053-37716075 CTCTGCATTTTAAGAGGAGAGGG - Intronic
1166906735 19:46115724-46115746 CTTTCCATGTCAAGAGCAGCTGG - Intergenic
1167872407 19:52382482-52382504 CTTAGAAAATGAAGAGCTGAGGG - Intronic
1168505749 19:56933354-56933376 CCTTGCAAATGAAGAGAAAATGG - Intergenic
926339916 2:11896395-11896417 ATTTGCAGATGATGGGCAGAGGG - Intergenic
932742468 2:74302269-74302291 CATAGTATAGGAAGAGCAGACGG + Intronic
933653189 2:84865500-84865522 CTTTGCATGTGGAAAGCAGAGGG + Intronic
934975173 2:98797120-98797142 CTTTGCATATGCTGAGCTGTTGG - Intronic
935716851 2:105946951-105946973 CTTTCCATATGGACAGCTGAAGG + Intergenic
936847367 2:116853633-116853655 CTTTGAAAGTGAAGAACAGAAGG + Intergenic
938259555 2:129885450-129885472 CTTTGTATATGAAGTGCTCAAGG - Intergenic
939369397 2:141278651-141278673 CTTTGCATAGAAGGAGCAAAGGG + Intronic
940388623 2:153104752-153104774 CATTGCAAATGAAAAGCAAATGG - Intergenic
940512054 2:154628055-154628077 CTTTGCAGGTGAAGAGGTGAGGG - Intergenic
940982331 2:160017587-160017609 CCTAGCATATAAAGAGGAGATGG - Intronic
941678663 2:168371506-168371528 CTCTGCCTGTGAAAAGCAGAAGG + Intergenic
943680720 2:190764725-190764747 CTTGGCCTATGAACAGCTGAAGG - Intergenic
946356226 2:219187144-219187166 TTTTGGATATAATGAGCAGAAGG - Intergenic
946536164 2:220631290-220631312 CTTTGCATATGGAGAGAAAGGGG + Intergenic
946896140 2:224326383-224326405 TTTTTGATATGAGGAGCAGAAGG - Intergenic
947675342 2:231974067-231974089 CTTTGCATATGAAAGGAAAAAGG - Intronic
947979081 2:234393527-234393549 CTTTGCAGATCATGAGCAGAAGG - Intergenic
948147572 2:235719625-235719647 CTTTGCAGATGAAGAAAGGAAGG - Intronic
948945227 2:241215973-241215995 CTTTGCAATTGAAGGGCAGCAGG - Intronic
1169346105 20:4829103-4829125 GTTTGCGTAAGAAGACCAGAGGG + Intergenic
1169611654 20:7387594-7387616 CTTTCCATGTGCAAAGCAGAGGG + Intergenic
1169628621 20:7600348-7600370 CTCTGCTTAAGAAAAGCAGAGGG + Intergenic
1170010537 20:11717735-11717757 CTTTGAATCCGAAGAGCAAATGG - Intergenic
1170380345 20:15752895-15752917 TTTAGCATATGAAGAGAATAAGG + Intronic
1173829360 20:46070589-46070611 TTTCTCATATGAAGAGCTGATGG - Intronic
1174498648 20:50967780-50967802 CATGGCATATGGAGAGCCGAGGG + Intergenic
1174627925 20:51930663-51930685 CTTTGCATATGAAGAGCATGAGG + Intergenic
1177222636 21:18214560-18214582 ATTTGCAAATGAAGAGCTAATGG - Intronic
1178741241 21:35203813-35203835 CTTTGCAGATGATGATCAGCAGG + Intronic
1179518720 21:41928112-41928134 CCTTTAACATGAAGAGCAGAAGG + Intronic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1182181113 22:28349110-28349132 CTTTGGAAAAGCAGAGCAGAAGG + Intronic
1184330241 22:43822503-43822525 CTTTTCAGATGAAGAGCGGGGGG + Intergenic
953365878 3:42344591-42344613 CTTTGCATAAGAAGAGGGGCTGG + Intergenic
955572468 3:60322937-60322959 CTTTGAATAAAAGGAGCAGAAGG + Intronic
955984615 3:64559652-64559674 CTTTGCATGTGTCGTGCAGATGG - Intronic
956581865 3:70822602-70822624 CTTTGCTTTTGAACAGCAGGTGG + Intergenic
959725028 3:109533283-109533305 CTTTGCTTGAGAAAAGCAGAAGG - Intergenic
959902191 3:111673786-111673808 CTTTGCACATGAAAATCACAGGG - Intergenic
962041692 3:131714029-131714051 CTTTGCATGTGAGAAGCAGAAGG + Intronic
962802517 3:138902477-138902499 CTATGCATATTAATAGCAAAGGG - Intergenic
963174025 3:142280092-142280114 CTTTCCAGATCAAGGGCAGAGGG - Intergenic
963448047 3:145440100-145440122 TTCTGCATATGAAAAGCAGAGGG + Intergenic
963785681 3:149532103-149532125 CTTTACAAATGAAGAACAGAGGG - Intronic
964435648 3:156649828-156649850 CTCAGCATATCAAGAACAGAAGG + Intergenic
964531897 3:157677515-157677537 GTTTTCATAGGATGAGCAGAAGG + Intronic
964804143 3:160588092-160588114 CTCTGCCTATGGAAAGCAGAGGG + Intergenic
965749382 3:171960495-171960517 CTTTTCATAAGAAAAGCAAAGGG + Intergenic
966622046 3:181975979-181976001 CTTTGTATATGATGAAAAGAAGG + Intergenic
966728539 3:183130971-183130993 CTTTCCAGGTGGAGAGCAGAGGG - Intronic
967415147 3:189208676-189208698 TTCTGCATATGTAGAGCATATGG + Intronic
967753823 3:193145830-193145852 CTTTGCTTATGAACTGGAGATGG + Intergenic
972279513 4:37588555-37588577 TTTTGCAGATGAGGAGAAGAAGG - Intronic
972782015 4:42294507-42294529 TTTTACATGTCAAGAGCAGAAGG + Intergenic
973720314 4:53717282-53717304 CTTTGCATTTTCAGGGCAGAAGG + Intronic
973779712 4:54277014-54277036 GTTTGCATATGGAAAACAGAAGG + Intronic
976250165 4:83042229-83042251 CTTTGTATTTGAAGATCATATGG - Intronic
977289344 4:95146630-95146652 GTTTGCAGATGAAAAGAAGATGG - Intronic
978898179 4:113915797-113915819 CACTGAATATGAAAAGCAGATGG + Intronic
979001421 4:115225665-115225687 CTTTGCCCATGGAGAGGAGAGGG + Intergenic
979208529 4:118072012-118072034 TTTTTTATATGAAGATCAGATGG + Intronic
979768069 4:124487055-124487077 ATTTGCATATGAGGGGAAGAAGG + Intergenic
981559392 4:146030390-146030412 CTATGCATTTGAACAGCCGAGGG - Intergenic
983456330 4:167969036-167969058 CTCTGCCTTTGAAGAGGAGAGGG + Intergenic
983779382 4:171649379-171649401 CTTATCATTTGAAGAGCAGCTGG - Intergenic
983786581 4:171738820-171738842 CTTTTAATATGAAAGGCAGAAGG - Intergenic
985004444 4:185519866-185519888 CATTGCAGATGAATAGCAAAAGG - Intronic
985753933 5:1701882-1701904 CTTTGTGGATGAAGACCAGAAGG + Intergenic
986300297 5:6473172-6473194 TTTTGAAAAGGAAGAGCAGAGGG - Intronic
986593732 5:9398637-9398659 CTTTTCATCTGAAGGGCAGAAGG - Intronic
987468579 5:18302487-18302509 TTTTGCATATGATGAGAGGAAGG + Intergenic
987756848 5:22107429-22107451 ATATATATATGAAGAGCAGAAGG - Intronic
988847517 5:35143469-35143491 CTTTGCATAAGGTGATCAGAGGG - Intronic
991224837 5:64258028-64258050 CTTTGCATGGGAAAGGCAGAGGG + Intronic
992379666 5:76224791-76224813 CTGTGCTTGTGAAGAACAGATGG - Intronic
992452866 5:76888996-76889018 ATTTGCATATTAAGAGCCTAGGG + Intronic
992617942 5:78563205-78563227 TTTTGCATCTGAACAGCACATGG + Intronic
994677784 5:102846764-102846786 CTTTGTAAATCAAGAGAAGAAGG - Intronic
994751702 5:103746081-103746103 CTTTTCATAGGATGATCAGATGG - Intergenic
994912319 5:105927496-105927518 CTTTCCATCAGAAAAGCAGAAGG - Intergenic
996091373 5:119355370-119355392 CTTTGCACAGCAAAAGCAGACGG - Intronic
997132533 5:131291727-131291749 ATTTGTATTTAAAGAGCAGAGGG - Intronic
997624033 5:135319605-135319627 CTGCGCATATGAAGAACAGGTGG + Intronic
997654723 5:135546376-135546398 CTTTGCATCTGAAGTGGAGATGG + Intergenic
1001317052 5:170651072-170651094 CTCTGCCTCTGAAGGGCAGAGGG + Intronic
1001740653 5:174050530-174050552 CTTTACAGATGAAGAGTGGAAGG + Intronic
1003790971 6:9547149-9547171 CATTGGCTTTGAAGAGCAGAAGG + Intergenic
1004789883 6:19013346-19013368 GTTTGGATATGAAAAGCAGTGGG - Intergenic
1005136148 6:22570778-22570800 CCTGGCAGATAAAGAGCAGAGGG + Exonic
1005265326 6:24106463-24106485 CTTTGCATATGGACTGCATATGG + Intergenic
1006859490 6:37160687-37160709 CTCTGCACTTGAAGAGCTGATGG + Intergenic
1007028527 6:38603772-38603794 TTTTGCAATTAAAGAGCAGAAGG - Intronic
1007345143 6:41223479-41223501 CTGTGCATGTGAGGAGCAGGAGG - Intergenic
1010033078 6:71289449-71289471 CTTTGCCTCTGCAGAGCAGCTGG + Intronic
1011352782 6:86440864-86440886 TATTGCATATAAAAAGCAGATGG - Intergenic
1011765407 6:90614433-90614455 CTTGGCATATGTTGAGCTGAAGG - Intergenic
1013281276 6:108639241-108639263 CTTTGCATATGAAAGGAAGCAGG - Intronic
1014355602 6:120405561-120405583 CTTTCCATATGATGAGCAATAGG + Intergenic
1015085446 6:129285004-129285026 CCTTGCATATGAAAATGAGAGGG + Intronic
1016136880 6:140554962-140554984 ACTTGCTTATGAAAAGCAGAGGG - Intergenic
1017538790 6:155378083-155378105 CTATGCATATGAAGAATTGAAGG + Intergenic
1018674293 6:166205738-166205760 CTTTAGATATGAAGACCAAAAGG + Intergenic
1019734465 7:2644013-2644035 CTCTGCAAGTGGAGAGCAGAGGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022136362 7:27453134-27453156 ATTTGAAAATGAAGAGAAGAGGG + Intergenic
1022176478 7:27876063-27876085 CTATGCAAATGTAGACCAGAAGG - Intronic
1023689974 7:42775576-42775598 CTTTGCTTCTGAAGATTAGATGG - Intergenic
1024077317 7:45828353-45828375 CTTTGCAAATGAAGAAAATAAGG - Intergenic
1024461125 7:49660625-49660647 CTTTGCATATTGAGAGCATATGG + Intergenic
1024666209 7:51549790-51549812 CTGAGCATATGAGGAACAGAAGG + Intergenic
1028895836 7:96040574-96040596 CTTTGCATATGTTGAGCTAAAGG + Intronic
1029348461 7:99995883-99995905 CTTTGTATATGAAGACCATGTGG + Intergenic
1030175987 7:106654122-106654144 CATTTCATTTTAAGAGCAGAAGG + Intergenic
1030408739 7:109147531-109147553 CTTTGCTTATTAATAGCAAAGGG + Intergenic
1030539227 7:110808599-110808621 CTTTGCAGCTGCAGTGCAGATGG + Intronic
1031118586 7:117694926-117694948 TTTTGCTTCTGAAGACCAGACGG + Intronic
1032462787 7:132124239-132124261 CTTTTCATTTTAAGAACAGAAGG + Exonic
1033271971 7:139940153-139940175 CTTTGCATATGAAGAGCAGAGGG + Intronic
1033867835 7:145713997-145714019 TTTTGCTTGTGAAGAGGAGAGGG - Intergenic
1035914968 8:3608887-3608909 CATTGCATATGCTGAGCAGAAGG - Intronic
1036129455 8:6095295-6095317 ATTTGCACTTGAAAAGCAGATGG - Intergenic
1036448579 8:8845123-8845145 CTTTGCATATGAATGACAGAGGG - Intronic
1037391921 8:18402436-18402458 CATTGCATAATAAGGGCAGAAGG - Intergenic
1037606122 8:20438628-20438650 CTTTGAATCTGATGAACAGAGGG + Intergenic
1042470029 8:69176649-69176671 CTTTTCCTATAAAGAGCAGATGG - Intergenic
1042506170 8:69563176-69563198 GTTTGCATGTGGGGAGCAGATGG - Intronic
1042520784 8:69709142-69709164 CTTTGCATATAAAAGGAAGAAGG + Intronic
1043210720 8:77512814-77512836 CTTAGCATATGAAGTACACAAGG + Intergenic
1044373860 8:91446521-91446543 CTTTGCCTAGGAATATCAGAAGG + Intergenic
1045379687 8:101610950-101610972 CTTTCGATATTAAGGGCAGAAGG + Intronic
1046291795 8:112172030-112172052 CTTTGCATATGAAGAATCAAAGG + Intergenic
1046675835 8:117107390-117107412 CATTGGATTTGAGGAGCAGATGG + Intronic
1047297132 8:123581122-123581144 ATTGGCATATCAACAGCAGAAGG + Intergenic
1047890654 8:129304312-129304334 TTTTGCATATGAACATCAGGTGG - Intergenic
1049202401 8:141346734-141346756 CCTTGCAGATGGAGTGCAGATGG - Intergenic
1050378446 9:4998066-4998088 TTTTGAATATCAATAGCAGAGGG + Intronic
1050705625 9:8393499-8393521 TTTTGCTTATGAGGAGCAGAAGG - Intronic
1053019230 9:34683482-34683504 CTGTGGATAGGAAGAGGAGAGGG - Intergenic
1053335029 9:37260432-37260454 CTTTGTAGATGAAGACCAGTGGG - Intronic
1053473260 9:38361873-38361895 CTTTGCAAATGATTATCAGATGG - Intergenic
1055347335 9:75352697-75352719 CTTTGGAGATGAAGAGTAAAGGG + Intergenic
1056255750 9:84797454-84797476 ATTTCCACATGAAGAGAAGAGGG - Intronic
1057646759 9:96883857-96883879 CATGGCATATGAGAAGCAGAAGG - Intergenic
1060654376 9:125358978-125359000 CTTTGTAGATGAAGAGAAGTAGG - Intronic
1185943125 X:4343523-4343545 CTTTGCCTATCAAGAGATGAAGG - Intergenic
1186528519 X:10271695-10271717 CTTTGCTTAGGAAAACCAGATGG + Intergenic
1186824536 X:13326176-13326198 CTATGCACATGATGATCAGATGG - Intergenic
1187612869 X:20961382-20961404 CTCTGCATGAGAAAAGCAGAGGG + Intergenic
1188116487 X:26250730-26250752 TTCTGCTTATGAAGAGGAGAGGG + Intergenic
1188647040 X:32582015-32582037 CTTAGAATATTAAGAACAGAAGG + Intronic
1189258440 X:39658923-39658945 CTTTTCAAAGGCAGAGCAGAAGG - Intergenic
1193092620 X:77510702-77510724 CTTTGCTTGTGAAAAGCGGAGGG + Intronic
1193684642 X:84562255-84562277 ATATGCATATGAACTGCAGAAGG + Intergenic
1194678623 X:96824423-96824445 CTTGTAATACGAAGAGCAGACGG - Intronic
1195244828 X:102986139-102986161 TTTTGCATAGGAAGAGCATGGGG - Intergenic
1195731523 X:107973125-107973147 CTTTTCATGGGAAGAGCAGGAGG + Intergenic
1195922883 X:110001074-110001096 ATTTGCATATAATGAGCAGTGGG + Intergenic
1197170518 X:123428722-123428744 TTTTGCCTATGAGGAGCTGAGGG - Intronic
1197562322 X:128038295-128038317 TTTTGCATATAAAGAGTAGGTGG + Intergenic
1198337030 X:135676397-135676419 CAATGCCTATGAAGAGAAGATGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199047267 X:143189672-143189694 CTTTGCATAGAAGGTGCAGATGG - Intergenic
1199543095 X:148979423-148979445 GTAGGCATATGAAGAGAAGAGGG - Intronic
1200314668 X:155119498-155119520 CTTTTGAAATGAAGAACAGAGGG - Intronic
1201625937 Y:16014262-16014284 ATTATCATGTGAAGAGCAGAAGG - Intergenic