ID: 1033277397

View in Genome Browser
Species Human (GRCh38)
Location 7:139982727-139982749
Sequence TGTGGGCTGTGATCCTTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 152}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033277397_1033277406 14 Left 1033277397 7:139982727-139982749 CCCCTAAAGGATCACAGCCCACA 0: 1
1: 0
2: 3
3: 15
4: 152
Right 1033277406 7:139982764-139982786 GGGTTAGAGGGTCACAGTTCAGG 0: 1
1: 0
2: 0
3: 10
4: 99
1033277397_1033277408 30 Left 1033277397 7:139982727-139982749 CCCCTAAAGGATCACAGCCCACA 0: 1
1: 0
2: 3
3: 15
4: 152
Right 1033277408 7:139982780-139982802 GTTCAGGAAAATGAACGAGGAGG No data
1033277397_1033277402 -6 Left 1033277397 7:139982727-139982749 CCCCTAAAGGATCACAGCCCACA 0: 1
1: 0
2: 3
3: 15
4: 152
Right 1033277402 7:139982744-139982766 CCCACATGTTGAAAAACACTGGG 0: 1
1: 0
2: 2
3: 18
4: 216
1033277397_1033277407 27 Left 1033277397 7:139982727-139982749 CCCCTAAAGGATCACAGCCCACA 0: 1
1: 0
2: 3
3: 15
4: 152
Right 1033277407 7:139982777-139982799 ACAGTTCAGGAAAATGAACGAGG No data
1033277397_1033277404 1 Left 1033277397 7:139982727-139982749 CCCCTAAAGGATCACAGCCCACA 0: 1
1: 0
2: 3
3: 15
4: 152
Right 1033277404 7:139982751-139982773 GTTGAAAAACACTGGGTTAGAGG No data
1033277397_1033277400 -7 Left 1033277397 7:139982727-139982749 CCCCTAAAGGATCACAGCCCACA 0: 1
1: 0
2: 3
3: 15
4: 152
Right 1033277400 7:139982743-139982765 GCCCACATGTTGAAAAACACTGG 0: 1
1: 0
2: 4
3: 26
4: 229
1033277397_1033277405 2 Left 1033277397 7:139982727-139982749 CCCCTAAAGGATCACAGCCCACA 0: 1
1: 0
2: 3
3: 15
4: 152
Right 1033277405 7:139982752-139982774 TTGAAAAACACTGGGTTAGAGGG 0: 1
1: 0
2: 5
3: 72
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033277397 Original CRISPR TGTGGGCTGTGATCCTTTAG GGG (reversed) Intronic
901391380 1:8948517-8948539 TGGGGGCTGTGTTCCTGTTGGGG + Intronic
902121326 1:14168483-14168505 TCAGGGCTGTGTTCCATTAGAGG + Intergenic
902364602 1:15963642-15963664 TTTGGGCTGTAGTCCTTTTGGGG - Intronic
903767060 1:25741752-25741774 TGTGGGCAATGAGCCATTAGAGG + Intronic
907746599 1:57219821-57219843 TCTGGGCTGTGTTCATTTTGTGG - Intronic
910809876 1:91225298-91225320 TGTGGGCTGTCCCCCTTTTGTGG + Intergenic
911222454 1:95263315-95263337 TGTGGGTTAAGAGCCTTTAGAGG - Intergenic
912543680 1:110435649-110435671 TGTGGATTGAGATCCATTAGTGG + Intergenic
912703077 1:111893120-111893142 TCTGGACTGTGAGCCTTCAGAGG - Intronic
914769439 1:150670665-150670687 TGTTGGTAGTGATCCTCTAGAGG - Intronic
915279847 1:154814938-154814960 TGTGTGCTGTGATCATCCAGGGG + Intronic
915771648 1:158432081-158432103 AGGGAGTTGTGATCCTTTAGAGG + Intergenic
917181541 1:172302973-172302995 GATGAGCTGTGATCCTTTGGAGG - Intronic
919461529 1:197883572-197883594 GAGGGGCTGTGATCCTTTGGAGG + Intergenic
922897327 1:229110625-229110647 TGAGGGCTGTGATTCTTCACTGG - Intergenic
924379804 1:243451979-243452001 TGTGGGTCATGACCCTTTAGTGG - Intronic
1063683835 10:8216774-8216796 GGTGGACTGTGAACCTTTTGGGG + Intergenic
1067088865 10:43256542-43256564 TGTGGGCAGGGATCCTGGAGAGG - Intronic
1071070557 10:81687592-81687614 TGTGGGCTGTGAGCCTTTCGAGG + Intergenic
1075356106 10:121778232-121778254 TGTAGGCTGTGATCTTTTAGTGG + Intronic
1075670454 10:124260750-124260772 TGTGGGCTGTGATCCATGGAAGG + Intergenic
1076338354 10:129725727-129725749 TGTGAGCTGTGCTCCTCTTGAGG - Intronic
1076991926 11:279959-279981 CGTGGGCTGTGGTCCCGTAGAGG + Intronic
1077878061 11:6324330-6324352 TGTGGGCAGTGAGCTTTTATAGG + Intergenic
1080954863 11:37081673-37081695 AATGGGCTGTGATACATTAGTGG + Intergenic
1083809802 11:65097149-65097171 TGGGGGCTGTGAGACTTTGGAGG - Intronic
1084279507 11:68078272-68078294 TGTGGCTTGTGAACCTCTAGTGG - Intronic
1088817038 11:113428486-113428508 TGAGGGCTGTGGTCCTGCAGGGG + Intronic
1091037661 11:132248008-132248030 TGTGGGCTGTGACCATTTAATGG - Intronic
1091129658 11:133134694-133134716 TGTGGGCTGGGCTCCTTTGCAGG - Intronic
1093069305 12:14691872-14691894 TTTGGGCTGTGATTTTTTACAGG + Intronic
1096193671 12:49635397-49635419 TCTGGGCTGTGGTCCCTGAGAGG + Exonic
1099522637 12:83682640-83682662 GGTGAGTTGTGATCCTTTGGAGG - Intergenic
1100488508 12:95055142-95055164 TGTTGGCTAAGAGCCTTTAGGGG - Intronic
1101573026 12:105972494-105972516 TGTGGGCTGTGTTCCTTTCTAGG - Intergenic
1106606577 13:31234584-31234606 TGTGGGCTGTGATGCTGTCCTGG + Intronic
1107385131 13:39900022-39900044 TGTGGGGTGTCATCCTTGTGTGG - Intergenic
1112374087 13:98822618-98822640 TGTGGGCCTTGATCCTTCAGTGG + Intronic
1115842614 14:37489495-37489517 AATGAGCTGTGATCCTTTGGAGG + Intronic
1117027515 14:51636687-51636709 TGTGGGATGTGACCCCTTAAAGG + Intronic
1117369491 14:55063219-55063241 TGTGGGATACGATCCTGTAGGGG - Exonic
1117991283 14:61436316-61436338 TGTGGGCTGAGATTCCTCAGAGG + Intronic
1118676382 14:68189221-68189243 CCTGGGCTGTGAGCCTTCAGAGG + Intronic
1118822684 14:69355389-69355411 GGTGGGCTGTGCTCCCTGAGAGG - Exonic
1120979806 14:90279791-90279813 TGTGGGCTGTGATTCCTTGGAGG - Intronic
1122825145 14:104367157-104367179 TGTGGGCCTTACTCCTTTAGGGG + Intergenic
1128673241 15:69590273-69590295 TGTGGGCTGAGGTCCCTCAGTGG - Intergenic
1129208327 15:74050734-74050756 TATGGACTGTGAGCCTTTGGAGG + Intergenic
1129578595 15:76780979-76781001 GGGGAGCTGTGATCCTTTGGAGG - Intronic
1133264431 16:4574928-4574950 TGAGGGCTGTGAGCCTGGAGGGG - Intronic
1133885204 16:9821040-9821062 TCTGGGCTTTGATGCTTTAGAGG + Intronic
1137036412 16:35573509-35573531 GCTGGGGTGTTATCCTTTAGCGG + Intergenic
1138222929 16:55268377-55268399 TGAGGGCTGAGATTCTTCAGAGG - Intergenic
1139561855 16:67748152-67748174 GGTGGGCTGTGATCGTTGACTGG + Intronic
1144772496 17:17767663-17767685 TGTGTGCTGTGATCCTTCAGGGG + Intronic
1146224368 17:31052788-31052810 GGTGGGCTGTGATACTTTGTAGG + Intergenic
1150491040 17:65574540-65574562 TGGGGGCTGTGATGCTGTACAGG - Intronic
1151765544 17:76131653-76131675 TGGGGGCTGTGATGCTTCAAAGG + Intergenic
1152918086 17:83052210-83052232 TGTGGGCTGTGCTACTTGACCGG + Intergenic
1154101424 18:11478493-11478515 TGTGAGTTGTGATCCTTTGGAGG + Intergenic
1154122299 18:11661736-11661758 TCTGGGCTGGGACCCTTAAGGGG - Intergenic
1155101735 18:22617288-22617310 GAGGGGCTGTGATCCTTTGGAGG - Intergenic
1159633381 18:70776192-70776214 TGTGGGTTGGAAGCCTTTAGGGG + Intergenic
1159957850 18:74532602-74532624 TGTGGGCTGTGATCCTAGGAGGG - Intergenic
1162717707 19:12644323-12644345 GGTGGGCTGTCATCCTGCAGAGG - Intronic
1164314347 19:24073720-24073742 TGTGGACTGTGTCCCCTTAGTGG - Intronic
1166406275 19:42524315-42524337 TGTGGGCTCACATCCTCTAGTGG - Intronic
927941519 2:27106093-27106115 TCTGGGCTGTGACCCTTTGACGG - Intronic
930266957 2:49210972-49210994 GATGAGCTGTGATCCTTTGGAGG - Intergenic
930288925 2:49468608-49468630 TGTGGGCTGAGATGCTATGGGGG - Intergenic
931494288 2:62785236-62785258 TGTGGGTTATGATCCATTAGTGG - Intronic
932646655 2:73510260-73510282 TGAGAGTTGTGATCCTTTGGAGG + Intronic
935232844 2:101114336-101114358 TAAGGGCTGGGATCCTTTATCGG + Intronic
935777232 2:106484489-106484511 GGTGGGCTGTGGGCGTTTAGTGG - Intergenic
936649766 2:114413028-114413050 GAGGAGCTGTGATCCTTTAGAGG + Intergenic
937139704 2:119589248-119589270 TGTTGGCTGTTATACTTTTGAGG + Intronic
937604404 2:123780107-123780129 TGTGGCCTCTCATCCTTTAGGGG + Intergenic
938319511 2:130353800-130353822 TGTGGCCTGTGAACATTAAGTGG - Intergenic
940086217 2:149862071-149862093 TGTGGGCTTTGATCTCTTATAGG - Intergenic
942668987 2:178353188-178353210 AAGGAGCTGTGATCCTTTAGAGG - Intronic
943010985 2:182449024-182449046 TGTATGATGTGATCCTGTAGTGG - Intronic
945863400 2:215149555-215149577 TGTAGGCTGTAACCCTTTACAGG - Intergenic
946706337 2:222462065-222462087 TCTGAGCTGTGGTCCTTGAGAGG + Intronic
947987589 2:234462384-234462406 TTTGGGCTGTGATCCTCTTAGGG + Intergenic
948989727 2:241547564-241547586 TGTGGGCTTTTCTCCTTTAGAGG - Intergenic
1169880926 20:10345604-10345626 TGTGAGGTTTGATCCTTTAATGG - Intergenic
1170613414 20:17931603-17931625 TGTGGGCTCTCATCCTCCAGTGG - Intergenic
1173330755 20:42074495-42074517 TGTGGACTCTGATCCTTAATTGG - Exonic
1173669715 20:44790273-44790295 TGTGTCCTGAGTTCCTTTAGTGG - Intronic
1175019192 20:55826372-55826394 TGTGGACTTTGGTCCTATAGTGG - Intergenic
1178268201 21:31164903-31164925 TGTCAGCTGTGATTCTTCAGTGG + Intronic
1181543922 22:23590090-23590112 TCTGGGCTCTGTTGCTTTAGAGG - Intergenic
1183760045 22:39807716-39807738 TGTGGGTTGTGACCAATTAGTGG + Intronic
1184378060 22:44127579-44127601 TCTGGGCTGTCAGCCATTAGTGG + Intronic
949353774 3:3155376-3155398 TGTGGGCAGTGATTCATTAAGGG + Intronic
951619294 3:24583356-24583378 TGATGGCTGGGATCCTTTTGGGG + Intergenic
952665521 3:35899591-35899613 TTAGGGCTGTCATCCTTTAAGGG + Intergenic
956068223 3:65419451-65419473 TGTGGGCTGTGACCTATTACTGG - Intronic
959157870 3:102688447-102688469 TGTGGGATTTTATCCCTTAGGGG - Intergenic
959678861 3:109069323-109069345 CGTGAACTGTGATCATTTAGTGG + Intronic
961395995 3:126591012-126591034 GATGAGCTGTGATCCTTTGGAGG + Intronic
962369095 3:134805875-134805897 TGTGGAATGTGATCCCATAGAGG - Intronic
966477673 3:180368447-180368469 GAGGAGCTGTGATCCTTTAGAGG - Intergenic
969058250 4:4415403-4415425 TGTGGGGTGTGTGCCTTGAGGGG - Intronic
969970902 4:11047300-11047322 TGAGAGTTGTGATCCTTTGGAGG + Intergenic
973556700 4:52091336-52091358 TATGAGTTGTGATCCTTTGGAGG + Intronic
976275745 4:83275721-83275743 TGTGGGATGTAAACGTTTAGAGG + Intronic
977310665 4:95382936-95382958 TGTGGGCTGTGTTGGTTTTGGGG + Intronic
979705406 4:123714134-123714156 TGAGGAGTGTGATCCTTTGGAGG - Intergenic
980100530 4:128537233-128537255 TGTGGGCTGTGTGCATTTTGTGG + Intergenic
980509243 4:133762884-133762906 TGTCGGCTGAGATCCTGTCGGGG + Intergenic
982017505 4:151169445-151169467 TCTGGGCTGTGATCCATGTGAGG + Intronic
982615097 4:157631607-157631629 TGTGGGCTGTGATCTGGTAAGGG - Intergenic
984525924 4:180859780-180859802 GATGGGTTGTGATCCTTTGGAGG + Intergenic
984564672 4:181313829-181313851 TGTGGGTTGTGACCCAGTAGTGG + Intergenic
986253101 5:6079122-6079144 TGCGGGCTGTAACCCTTTATAGG + Intergenic
986788703 5:11139834-11139856 TGTTGGCTGTGTTCCTTCTGGGG + Intronic
987194707 5:15514766-15514788 ACTGGGCTGTGAACCTTCAGTGG - Intronic
989030016 5:37109312-37109334 TGTGTGCTGTGATTATTTTGGGG - Intronic
989614633 5:43327916-43327938 GATGAGCTGTGATCCTTTGGAGG + Intergenic
990161282 5:52943452-52943474 TTTGAGCTGTGATCCAGTAGAGG + Intronic
994636671 5:102352391-102352413 AATGAGCTGTGATCCTTTGGAGG - Intergenic
995118683 5:108512099-108512121 TGTGGGCTATGGCCCTTTAGAGG - Intergenic
995620738 5:114022340-114022362 GAGGAGCTGTGATCCTTTAGAGG - Intergenic
999811887 5:155135387-155135409 TGTGAGCTGTGATCTTCTTGGGG + Intergenic
1000214397 5:159140636-159140658 GAGGAGCTGTGATCCTTTAGAGG - Intergenic
1000530011 5:162407992-162408014 TGTGGGCTTTGTTCTTTGAGAGG + Intergenic
1001680361 5:173552556-173552578 TGTGGTCTCTGCTCCTTAAGAGG + Intergenic
1003431786 6:6045576-6045598 TGTAGACTGTGATCATGTAGGGG - Intergenic
1004841487 6:19591044-19591066 TTTGGGCTCTGGTACTTTAGAGG + Intergenic
1007264295 6:40585631-40585653 TGTGGGCTGTTATTCTTGTGTGG - Intronic
1012582929 6:100890222-100890244 TGTGGGATACGATCCTGTAGGGG - Intergenic
1015191485 6:130476606-130476628 GGTGAGCTGTGTTCCTTTGGAGG - Intergenic
1016714812 6:147212601-147212623 TTTGGACTGTGTTCCTGTAGAGG + Intronic
1016770908 6:147849735-147849757 GATAGGCTGTGTTCCTTTAGAGG - Intergenic
1017235154 6:152111153-152111175 TGTGGGCTGTGGTCCCTTCCTGG - Intronic
1018166769 6:161105077-161105099 TATGGGTTGTGAACCATTAGTGG + Intronic
1022867094 7:34432404-34432426 GGGGAGCTGTGATCCTTTGGAGG - Intergenic
1023974956 7:45021863-45021885 TGTGGGTTATGATTCATTAGTGG + Intronic
1024673323 7:51616252-51616274 TTTGGGTGGAGATCCTTTAGTGG + Intergenic
1028078639 7:86547306-86547328 GAGGAGCTGTGATCCTTTAGGGG + Intergenic
1030500693 7:110355826-110355848 TGAGGACTGTGGTCCTTTGGAGG + Intergenic
1030664136 7:112255686-112255708 TTTGGGCAGTGATCCTCAAGAGG - Intronic
1030727673 7:112945156-112945178 TTTAGGCTGTGATTCATTAGAGG - Intergenic
1030755070 7:113277542-113277564 GGTGGTCTGTGATCATTTAAAGG - Intergenic
1031680323 7:124665035-124665057 TGTGGCCTGAGCTCCTTTAGGGG - Intergenic
1032685624 7:134231292-134231314 TGTGGTCTGTGATAGTTTATTGG + Intronic
1033277397 7:139982727-139982749 TGTGGGCTGTGATCCTTTAGGGG - Intronic
1035187195 7:157135786-157135808 TGTGAGCTGAGACCCATTAGTGG + Intergenic
1035760142 8:2062751-2062773 TGTGTGCTGTGAATGTTTAGGGG + Intronic
1037398439 8:18467980-18468002 GATGAGCTGTGATCCTTTGGAGG - Intergenic
1043938779 8:86173525-86173547 GAGGGGCTGTGATCCTTCAGAGG + Intergenic
1044808966 8:96038155-96038177 TAGGAGCTGTGATCCTTTAGTGG + Intergenic
1045549261 8:103155589-103155611 ACTCAGCTGTGATCCTTTAGCGG + Intronic
1046117112 8:109797770-109797792 TATGGTCTGTCATCCTTTGGAGG - Intergenic
1046412022 8:113858125-113858147 TGTGGTCTCTGATACTTGAGAGG + Intergenic
1048612821 8:136042241-136042263 TATGTGTTGTGATCCTTTAGGGG + Intergenic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1049729768 8:144170396-144170418 TGTGGGCTGTGACCCTTCCCAGG + Intronic
1053895502 9:42737892-42737914 GGTCGGCTGTGATCCGTTAAAGG + Intergenic
1056914279 9:90730877-90730899 TCTGGTCTCTGCTCCTTTAGAGG - Intergenic
1056993717 9:91435198-91435220 TCTGGGTTCTGATCATTTAGAGG - Intergenic
1060411367 9:123402662-123402684 TGAGGGCTGTGCTCCTTTTGCGG + Intronic
1186369890 X:8936442-8936464 GGTGAGTTGTGATCCTTTGGAGG + Intergenic
1186700673 X:12086839-12086861 TCTGGGCTGTGTTCCTTTCCTGG + Intergenic
1187445630 X:19358410-19358432 TGCTGGCTGTGCTTCTTTAGGGG + Intronic
1192043129 X:67644134-67644156 TGTGGGCTGAGCGCCTCTAGAGG - Intronic
1192497591 X:71626557-71626579 TGTGGCCTGTATTCCTTGAGGGG - Intergenic
1195379041 X:104254252-104254274 TGGGGGCTGTGGTCCCTCAGCGG + Exonic
1198071248 X:133150638-133150660 TTTGGGCAGGGATCATTTAGTGG - Intergenic
1198084383 X:133268551-133268573 AGTTGCCTCTGATCCTTTAGGGG + Intergenic