ID: 1033280590 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:140003655-140003677 |
Sequence | CAAGCCATACAGTTTTCTTC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 300 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 19, 4: 280} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1033280587_1033280590 | 22 | Left | 1033280587 | 7:140003610-140003632 | CCTATCTTTAAAAATTTTCTTTC | No data | ||
Right | 1033280590 | 7:140003655-140003677 | CAAGCCATACAGTTTTCTTCGGG | 0: 1 1: 0 2: 0 3: 19 4: 280 |
||||
1033280588_1033280590 | -10 | Left | 1033280588 | 7:140003642-140003664 | CCGTGACAACTTACAAGCCATAC | No data | ||
Right | 1033280590 | 7:140003655-140003677 | CAAGCCATACAGTTTTCTTCGGG | 0: 1 1: 0 2: 0 3: 19 4: 280 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1033280590 | Original CRISPR | CAAGCCATACAGTTTTCTTC GGG | Intronic | ||