ID: 1033280590

View in Genome Browser
Species Human (GRCh38)
Location 7:140003655-140003677
Sequence CAAGCCATACAGTTTTCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 280}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033280587_1033280590 22 Left 1033280587 7:140003610-140003632 CCTATCTTTAAAAATTTTCTTTC No data
Right 1033280590 7:140003655-140003677 CAAGCCATACAGTTTTCTTCGGG 0: 1
1: 0
2: 0
3: 19
4: 280
1033280588_1033280590 -10 Left 1033280588 7:140003642-140003664 CCGTGACAACTTACAAGCCATAC No data
Right 1033280590 7:140003655-140003677 CAAGCCATACAGTTTTCTTCGGG 0: 1
1: 0
2: 0
3: 19
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033280590 Original CRISPR CAAGCCATACAGTTTTCTTC GGG Intronic