ID: 1033282854

View in Genome Browser
Species Human (GRCh38)
Location 7:140018019-140018041
Sequence CACAGGATGTTGAGAGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 472}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033282854_1033282860 17 Left 1033282854 7:140018019-140018041 CCTCTACCTCTCAACATCCTGTG 0: 1
1: 0
2: 2
3: 38
4: 472
Right 1033282860 7:140018059-140018081 CACAGCGCTCAGGTAAGCCCTGG No data
1033282854_1033282859 7 Left 1033282854 7:140018019-140018041 CCTCTACCTCTCAACATCCTGTG 0: 1
1: 0
2: 2
3: 38
4: 472
Right 1033282859 7:140018049-140018071 AGTGAGTTCACACAGCGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033282854 Original CRISPR CACAGGATGTTGAGAGGTAG AGG (reversed) Intronic
900200629 1:1404093-1404115 CCCAGTATGTTGAGAGGCAGAGG - Intronic
901349614 1:8582483-8582505 CCCAGTATTTTGGGAGGTAGAGG - Intronic
901375443 1:8835063-8835085 CCCAGCATTTTGAGAGGTGGAGG + Intergenic
901421982 1:9157309-9157331 CACAGCATGTTTAGAGGTGGAGG + Intergenic
901424325 1:9171835-9171857 CACAGCACGTTGAGAGGCTGAGG + Intergenic
902858470 1:19226822-19226844 CCCAGCATTTTGAGAGGTCGAGG - Intronic
903390601 1:22961028-22961050 CACAGCATGTTGGGAGGCTGAGG - Intronic
903464424 1:23542250-23542272 CTCAGCATGTTGGGAGGTTGAGG - Intergenic
903737030 1:25536413-25536435 CACAGGAAGTTTAGGGGAAGGGG + Intergenic
906733326 1:48101742-48101764 CACAGGTTGCTGGGAGGTTGTGG + Intergenic
907454569 1:54567026-54567048 CACAGGATTTTGAGACGTTGTGG - Intronic
908392352 1:63695286-63695308 CACAACATGCTGTGAGGTAGGGG + Intergenic
908622664 1:66001971-66001993 CACAGCATTTTGGGAGGTTGAGG - Intronic
908792890 1:67801017-67801039 CACTGGATGTTTAAAGGTAAAGG + Intronic
908991307 1:70093872-70093894 CACAGGATGTTGTTAGAAAGAGG + Intronic
909079256 1:71089407-71089429 CCCAGGAGGTGGAGAGGTGGAGG - Intergenic
909860356 1:80597195-80597217 CCCAGCATTTTGAGAGGCAGAGG + Intergenic
912865542 1:113252922-113252944 CAAATGCTGTTGAGAGGTAGAGG + Intergenic
912981863 1:114381456-114381478 CCCAGCACTTTGAGAGGTAGAGG - Intergenic
913242356 1:116840074-116840096 CTCAGGAGGTGGAGAGGTGGAGG + Intergenic
913549973 1:119907662-119907684 CCCAGGATGTGGAGATGCAGAGG + Intergenic
915050269 1:153062831-153062853 CCCAGCACGTTGAGAGGTCGAGG + Intergenic
915420391 1:155776624-155776646 CACAGGAAGTTGAGAGGGCGTGG - Intronic
915444031 1:155964596-155964618 GAAAGGGTTTTGAGAGGTAGGGG + Intronic
915603029 1:156934244-156934266 CTGAGGATTGTGAGAGGTAGAGG + Intergenic
917201666 1:172523449-172523471 CACAGGAAGTCGAAAGATAGTGG - Intergenic
917592075 1:176486733-176486755 CAAAGGACGATGAGAGGGAGAGG + Intronic
918110502 1:181451433-181451455 CACAGCATTTTGAGAGGCTGAGG + Intronic
918987497 1:191651744-191651766 CACTGGAGGTTGGGAGGTGGAGG - Intergenic
920044729 1:203126034-203126056 CACAGGTTGCTGACATGTAGTGG - Intronic
920552476 1:206874404-206874426 CCCAGGACTTTGAGAGGTTGAGG + Intergenic
921675305 1:217969294-217969316 CACAGCATGGTGAGAGGTGGTGG - Intergenic
921749692 1:218777911-218777933 CAGAGGATGCTGAGAGGCAGGGG + Intergenic
921889775 1:220342164-220342186 CACATGATGTTTAAAGTTAGAGG - Intergenic
922660206 1:227423483-227423505 CCCAGCACTTTGAGAGGTAGAGG - Intergenic
923454676 1:234153674-234153696 CCCAGGATTTTGGGAGGCAGAGG + Intronic
923787508 1:237082204-237082226 CACAGGATCATGTGAGGTATGGG + Intronic
924047217 1:240044069-240044091 CCCAGGAGGTGGAGAGGCAGAGG - Intronic
924710771 1:246528300-246528322 CAGAGGAGGCTGAGAGGAAGAGG + Intergenic
1063019491 10:2113621-2113643 CCCAGCATGTTGAGAGGCTGAGG - Intergenic
1063090977 10:2866103-2866125 CACAGGATGTGGAGAAGTGAAGG + Intergenic
1063099518 10:2937110-2937132 CAAAGGATTTTGAGAGGGTGTGG + Intergenic
1063236424 10:4121408-4121430 CACAGTATTTTGGGAGGTTGAGG - Intergenic
1065083314 10:22148653-22148675 CTCAGGAGGTTGAGAGGTAGAGG - Intergenic
1065136084 10:22671599-22671621 CACAGGATGCTGGGAGGCAAAGG + Intronic
1066469949 10:35688650-35688672 CACAGGATGGTGAGGGTTAAAGG - Intergenic
1067694038 10:48522908-48522930 CACAGGACGTAGAGAGGTCAAGG - Intronic
1068878667 10:62025682-62025704 CACTGCATGTTGAGAAGTATAGG + Intronic
1069083869 10:64116944-64116966 CACAGGATGTTTACAGCTAAGGG + Intergenic
1069510046 10:69035408-69035430 CCCAGCATTTTGAGAGGTTGAGG + Intergenic
1071072341 10:81709500-81709522 CCCAGCATTTTGAGAGGCAGAGG + Intergenic
1071211843 10:83350264-83350286 CCCAGCATTTTGAGAGGTCGAGG - Intergenic
1072457148 10:95586701-95586723 CCCAGGACTTTGAGAGGCAGAGG - Intergenic
1073095739 10:100978656-100978678 CACAGGATGATGGGGGGTAGGGG + Intronic
1073311456 10:102545721-102545743 CCCAGCACTTTGAGAGGTAGAGG + Intronic
1073692175 10:105821280-105821302 AACAGGATGTTTTTAGGTAGAGG + Intergenic
1074392458 10:113069478-113069500 CCCAGCACTTTGAGAGGTAGAGG - Intronic
1074401996 10:113149243-113149265 CACATTATTTTGAGAGGAAGGGG + Intronic
1075051933 10:119188798-119188820 CCCAGCATTTTGGGAGGTAGAGG - Intergenic
1077150638 11:1071616-1071638 CACAGGATGTAGGGAGACAGGGG + Intergenic
1077999879 11:7485218-7485240 CACTGGCTGTTCAGAGATAGTGG + Intergenic
1078280990 11:9900979-9901001 CCCAGCATTTTGAGAGGTGGAGG - Intronic
1078774658 11:14383128-14383150 AACAGGATGGTGGGAGGTAGGGG - Intergenic
1078920606 11:15826781-15826803 CTCAGGATGATAAGATGTAGAGG - Intergenic
1079876939 11:25870568-25870590 CCCAACATGTTGAGAGGCAGAGG + Intergenic
1080787949 11:35493139-35493161 CTATGGATGGTGAGAGGTAGAGG - Intronic
1083005194 11:59338056-59338078 CCCAGGATGTGGAGTGGTAATGG - Intergenic
1083190794 11:61050696-61050718 CCCAGGAGGTGGAGAGGTGGAGG + Intergenic
1083832392 11:65241292-65241314 CCCAGCACGTTGAGAGGTTGAGG + Intergenic
1084439147 11:69161234-69161256 CACAGGAGGCTGAGAGATAGTGG + Intergenic
1084728443 11:71057797-71057819 CCCAGCATTTTGGGAGGTAGAGG - Intronic
1084997579 11:72997011-72997033 AACAGGAACTTGAGAGGTAAGGG + Intronic
1085570531 11:77554331-77554353 TTCAGCTTGTTGAGAGGTAGTGG - Intronic
1085636017 11:78160159-78160181 CCCAGCATTTTGGGAGGTAGAGG - Intergenic
1085636073 11:78160460-78160482 CCCAGCATTTTGGGAGGTAGAGG - Intergenic
1087375512 11:97335122-97335144 CACTGGATGTTAAGAGTTAAAGG + Intergenic
1087430658 11:98049357-98049379 CATATGATGTGGAGAGGTAGAGG - Intergenic
1087643918 11:100785510-100785532 CACTGGAGGTTAAGAGGTTGTGG + Intronic
1088625043 11:111723933-111723955 CACAGGATACTGACAGGGAGTGG - Exonic
1088691832 11:112334916-112334938 CACAGAATGTTGAAAAGGAGGGG + Intergenic
1089506997 11:118970233-118970255 CACAGCACGTTGAGAGGCTGAGG + Intergenic
1089947512 11:122492745-122492767 CCCAGCACTTTGAGAGGTAGAGG + Intergenic
1090366278 11:126209239-126209261 CACAGCACTTTGAGAGGCAGAGG - Intronic
1090423826 11:126593480-126593502 CACAGCAGGTTGGGAGGTACTGG - Intronic
1090657146 11:128854747-128854769 ATTAGGATGTTGAGAGGTGGTGG - Intronic
1091082317 11:132682185-132682207 CACAAGAGGTTGAGAGCTATGGG + Intronic
1091510903 12:1125076-1125098 CACATGAACTTGAGAGGTGGAGG - Intronic
1092059650 12:5537968-5537990 CACAGGCTGTGGAGGGGCAGAGG + Intronic
1092348704 12:7738287-7738309 CTCAGAATGTTGAGAGGTTGAGG + Intronic
1092875819 12:12846816-12846838 CCCAGCATGTTGGGAGGCAGAGG + Intergenic
1093347345 12:18054919-18054941 CACTGGATGTGGAGAGGAAATGG - Intergenic
1093745734 12:22739396-22739418 CCCAGGATTTTGGGAGGCAGAGG + Intergenic
1094024396 12:25947388-25947410 TCCAGGAAGTTGAGAGGTTGAGG - Intergenic
1094617984 12:32053406-32053428 CTCAGCATTTTGAGAGGCAGAGG - Intergenic
1094824326 12:34256765-34256787 CACAGCACTTTGAGAGGTGGAGG - Intergenic
1095502132 12:42851544-42851566 CCCAGCATTTTGAGAGGCAGAGG + Intergenic
1096138345 12:49221430-49221452 CCCAGCATTTTGGGAGGTAGAGG - Intronic
1096539441 12:52296749-52296771 TGAAGGAAGTTGAGAGGTAGTGG - Intronic
1096830310 12:54308689-54308711 CACAGCACTTTGAGAGGTTGAGG + Intronic
1097285148 12:57871305-57871327 CCCAGGTTGTTGAGAGGCTGAGG + Intergenic
1097317045 12:58182800-58182822 CAAAGTATTTTGGGAGGTAGAGG - Intergenic
1097505410 12:60462120-60462142 AACAGGATGTTGAGATGTGTGGG - Intergenic
1098771449 12:74558732-74558754 CCCAGCATTTTGAGAGGCAGAGG - Intergenic
1099275905 12:80575943-80575965 CAAAGGATGGTGTGAGGTTGGGG - Intronic
1099868825 12:88320512-88320534 CCCAACATGTTGAGAGTTAGAGG + Intergenic
1099886762 12:88540547-88540569 CCCAGAATTTTGAGAGGCAGAGG + Intronic
1100664236 12:96733518-96733540 CACAGGATTTTGAAAGAAAGAGG - Intronic
1102062109 12:109940627-109940649 CCCAGCATGTTGGGAGGCAGAGG + Intronic
1102355270 12:112229074-112229096 CACAGCATTTTGGGAGGTTGAGG + Intronic
1102503738 12:113370938-113370960 CCCAGGATGTTGGGAGGCTGAGG + Intronic
1102906771 12:116682415-116682437 CCCAGGATGTTGGGAGGCCGAGG + Intergenic
1102972691 12:117182811-117182833 CACAGCATTTTGAGAGGCCGAGG - Intronic
1103097187 12:118141481-118141503 CCCAGCATGTTGGGAGGTGGAGG + Intronic
1103450108 12:121022717-121022739 CAAAGGATGATGAGGGGTAAAGG - Intronic
1103543452 12:121682607-121682629 CCCAGGAGGTCGAGAGGTCGAGG + Intergenic
1104009950 12:124923245-124923267 CCCAGCACTTTGAGAGGTAGAGG + Intergenic
1104041379 12:125133592-125133614 CACAGGGTGTGCAGAGGTTGGGG - Intronic
1104090080 12:125509032-125509054 CCCAGCATGTTGAGAGGCCGAGG - Intronic
1104091380 12:125520664-125520686 AACAGGATGATGACAGGTAGAGG - Intronic
1106009868 13:25809663-25809685 CACAGGGTGTTGTGAGCTAGAGG - Intronic
1106858476 13:33878678-33878700 CACAGGATGTTCAGAGCTGTTGG + Intronic
1106922350 13:34577076-34577098 CACAGCACTTTGAGAGGTTGAGG + Intergenic
1106979454 13:35260227-35260249 CACAGGATATTGACAGGAACAGG + Intronic
1107121816 13:36804401-36804423 CACATGATCTTGTGAGGTATTGG - Intergenic
1107854558 13:44602218-44602240 CACAGCATTTTGGGAGGTCGAGG - Intergenic
1108415154 13:50190556-50190578 CCCAGCATTTTGAGAGGTTGAGG - Intronic
1108544461 13:51478549-51478571 CACAGGGTGTAGAGATGCAGAGG + Intergenic
1111710400 13:91805117-91805139 GACAGGATGGAGAGAGGGAGTGG + Intronic
1112459650 13:99592277-99592299 CCCAGCATGTTGGGAGGCAGAGG - Intergenic
1113090213 13:106610113-106610135 CTCAGCATGTTGAGAGGGGGAGG + Intergenic
1113357498 13:109596149-109596171 CACAGAAAGTTGAGTGGTGGAGG - Intergenic
1114009699 14:18354015-18354037 CACAGCATTTTGAGAGGCCGAGG - Intergenic
1114325075 14:21580824-21580846 CCCAGCATTTTGGGAGGTAGAGG - Intergenic
1115889693 14:38012692-38012714 CACAGGATGTTGAGCGCCTGAGG - Intronic
1116735276 14:48682566-48682588 CCCAGCATCTTGAGAGGCAGAGG + Intergenic
1117030786 14:51667877-51667899 GAAAGGATGTTGAGAGCTAATGG + Intronic
1118431114 14:65719951-65719973 CACAGGAGGTAGCCAGGTAGGGG - Intronic
1118686022 14:68292030-68292052 AACAGGAGGTGGAGAGGCAGTGG - Intronic
1118686917 14:68300458-68300480 CCCAGCATGTTGGGAGGTAGAGG - Intronic
1118730209 14:68660712-68660734 CACAGAATGTTTAGGGGAAGGGG + Intronic
1119186714 14:72648309-72648331 CCCAGCATTTTGAGAGGTCGAGG + Intronic
1122336460 14:100991283-100991305 CCCAGCATGTTGGGAGGCAGAGG - Intergenic
1123492597 15:20794509-20794531 TCCAGGATGTTGAGAGGCTGAGG + Intergenic
1123549098 15:21363601-21363623 TCCAGGATGTTGAGAGGCTGAGG + Intergenic
1124659038 15:31530279-31530301 GACAGGGTGTTTGGAGGTAGGGG - Intronic
1124996709 15:34730608-34730630 CCCAGTAGGTTGAGAGGTTGAGG - Intergenic
1125589522 15:40845622-40845644 CTCAGGATGTTCAGAGGTGATGG + Intronic
1126297782 15:47160503-47160525 CCCAGCATGTTGGGAGGTCGAGG + Intergenic
1126710312 15:51447587-51447609 CACACAATGTTGAGATTTAGCGG - Intergenic
1127219331 15:56861286-56861308 CCCAGCATTTTGAGAGGCAGAGG + Intronic
1127545912 15:59994299-59994321 AACAGGCTGCTCAGAGGTAGTGG + Intergenic
1127625011 15:60771826-60771848 CTCATGATCCTGAGAGGTAGGGG - Intronic
1128429078 15:67573659-67573681 TACAGGATGTTTAGAGTTAAGGG + Intronic
1128634927 15:69297100-69297122 CACAGGATGATCAGAGGAGGGGG - Intergenic
1128687982 15:69701050-69701072 TACAGGCTGTTCAGAGGGAGAGG - Intergenic
1129176530 15:73843756-73843778 CCCAGCACATTGAGAGGTAGAGG - Intergenic
1129649232 15:77469585-77469607 CACAGGATGTTGGGAGGCCAAGG - Intronic
1129955699 15:79634914-79634936 CACAGGATGGTGATAGGAAATGG + Intergenic
1130128149 15:81111662-81111684 CACAGGGTGATGAGAGGCAGAGG - Intronic
1130615234 15:85400147-85400169 CTCAGCATTTTGAGAGGTTGAGG + Intronic
1131317732 15:91355160-91355182 CACTGGGTGTGGAGAGGTTGAGG - Intergenic
1132273356 15:100545014-100545036 TACAGGCTGTTGATAGGAAGGGG + Intergenic
1202957433 15_KI270727v1_random:90823-90845 TCCAGGATGTTGAGAGGCTGAGG + Intergenic
1132916423 16:2348384-2348406 CCCAGGATTTTGAGAGGCTGAGG - Intergenic
1133400622 16:5483918-5483940 CCCAGCACTTTGAGAGGTAGAGG + Intergenic
1134620523 16:15685592-15685614 CACAGGGTCTTTAGAAGTAGTGG - Intronic
1134781993 16:16906750-16906772 CACAAGATGCAGAGAGGCAGAGG + Intergenic
1135170375 16:20178528-20178550 CACAGCAAGTGGAGAGGGAGTGG - Intergenic
1135550852 16:23397157-23397179 CACAGCACTTTGGGAGGTAGAGG - Intronic
1135861511 16:26060026-26060048 CCCAGCATGTTGAGAGGCCGGGG - Intronic
1136251644 16:29009389-29009411 CTCAGGATGTGGGGAGGGAGGGG - Intergenic
1136459711 16:30402128-30402150 CCCAGCATTTTGAGAGGTTGAGG + Intergenic
1137626025 16:49909252-49909274 CCCAGCACTTTGAGAGGTAGAGG - Intergenic
1137999563 16:53261447-53261469 CCCAGGAGGTTGAGAGGTCAAGG - Intronic
1139165283 16:64558415-64558437 CACAGCACTTTGAGAGGCAGAGG + Intergenic
1139287946 16:65832173-65832195 CCCAGGATGTTGAACGGGAGGGG - Intergenic
1139638491 16:68274008-68274030 CCCAGCATGTTGAGAGGCCGAGG - Intronic
1139870440 16:70104300-70104322 CCCAGCATTTTGGGAGGTAGAGG + Intergenic
1140272808 16:73481741-73481763 CCCAGGACTTTGAGAGGCAGAGG - Intergenic
1140385004 16:74528249-74528271 CCCAGCATTTTGGGAGGTAGAGG - Intronic
1140893903 16:79308391-79308413 CACAGGCTGTTAAGTGATAGAGG - Intergenic
1141518243 16:84560549-84560571 CACAGGATGCTGAGTGGGTGAGG + Intergenic
1143136452 17:4715144-4715166 CACAGGAAGTGGGGAGCTAGGGG - Intronic
1143146545 17:4780303-4780325 CCCAGCATGTTGAGAGGCTGAGG - Intronic
1143341289 17:6213356-6213378 GAGAGGGTGTTGAGAGGCAGTGG + Intergenic
1143659348 17:8315182-8315204 CACAGGGTGTTGCGAGGTCCAGG - Exonic
1143867328 17:9933590-9933612 CCCAGCATTTTGGGAGGTAGAGG + Intronic
1143906092 17:10210321-10210343 CACAGGGAGTAGGGAGGTAGAGG + Intergenic
1144140746 17:12345344-12345366 GACAGGATTTTGAGGGGCAGTGG - Intergenic
1144694353 17:17291932-17291954 CACAGCATTTTGGGAGGTTGAGG - Intergenic
1144873607 17:18384940-18384962 CAGAGGAGGCTGAGAGGGAGAGG + Intronic
1145158866 17:20560857-20560879 CAGAGGAGGCTGAGAGGGAGAGG - Intergenic
1145874903 17:28310329-28310351 CCCAGAATTTTGAGAGGCAGAGG - Intergenic
1146240544 17:31218820-31218842 CCCAGGACTTTGGGAGGTAGTGG - Intronic
1146629472 17:34459493-34459515 CACAGGATGTTCGGTGGTTGAGG - Intergenic
1146874953 17:36402202-36402224 CCCAGCATGTTGGGAGGTCGAGG - Intronic
1146885636 17:36469056-36469078 CACGGGATGTTGAGAGCTGCCGG - Intergenic
1146951490 17:36909807-36909829 AACATGATCTTGAGAGGTGGGGG + Intergenic
1147064435 17:37910678-37910700 CCCAGCATGTTGGGAGGTCGAGG + Intergenic
1147645865 17:42033498-42033520 CCCAGCATGTTGGGAGGTTGAGG + Intronic
1147667346 17:42156929-42156951 CCCAGGGTGTTGGGTGGTAGAGG + Exonic
1147841335 17:43373914-43373936 CCCAGCACTTTGAGAGGTAGAGG - Intergenic
1148794970 17:50192601-50192623 GTCAGGATGCTGGGAGGTAGGGG - Intronic
1149387781 17:56158651-56158673 CACAGCATGTGGGGAGGGAGGGG + Intronic
1149581650 17:57754777-57754799 CTCATTATGTTGAGAAGTAGGGG - Intergenic
1150110612 17:62495914-62495936 CACAGCACTTTGAGAGGCAGAGG - Intronic
1150145786 17:62767987-62768009 CACAGGAAGGTGATAGGCAGAGG - Intronic
1152042725 17:77915009-77915031 CTCAGGATGGTGAGGGGGAGTGG - Intergenic
1152471195 17:80490922-80490944 CACAGAATGTTGGCAGGGAGGGG + Intergenic
1153588249 18:6645965-6645987 CCCAGGATTCTCAGAGGTAGGGG - Intergenic
1154134287 18:11762110-11762132 CACAGGAGGTGGAGAGGGAGAGG + Intronic
1154450142 18:14469047-14469069 TCCAGGATGTTGAGAGGCTGAGG + Intergenic
1154972690 18:21426706-21426728 CCCAGCATGTTGGGAGGCAGAGG + Intronic
1155529267 18:26749495-26749517 CCCAGAATTTTGAGAGGTTGAGG - Intergenic
1155639895 18:28000350-28000372 CACAGCATTTTGGGAGGTTGAGG - Intronic
1158362867 18:56695783-56695805 CACTGGCTGTTGAGAGGCCGAGG - Intronic
1158744844 18:60188190-60188212 CACAGGATGGTGAGGGATTGCGG + Intergenic
1159055990 18:63464483-63464505 CCCAGCATTTTGAGAGGCAGAGG - Intergenic
1159531019 18:69655500-69655522 CCCAGCATGTTGGGAGGTCGAGG + Intronic
1161048990 19:2152022-2152044 CACAGGATGTTGTGAGGCTGCGG - Intronic
1162400574 19:10444128-10444150 CACAGCACTTTGGGAGGTAGAGG + Intronic
1162531324 19:11237924-11237946 GACAGGAAGAAGAGAGGTAGAGG - Intronic
1163278311 19:16299810-16299832 CCCAGTATTTTGAGAGGTGGAGG + Intergenic
1163838200 19:19589176-19589198 CCCAGCACGTTGAGAGGTCGAGG + Intronic
1164316862 19:24097529-24097551 CCCAGGATTTTGGGAGGTTGAGG + Intronic
1164872843 19:31660690-31660712 CTCAGCATGTTGAGAGGCTGAGG + Intergenic
1164945511 19:32289986-32290008 CCCAGCACTTTGAGAGGTAGAGG + Intergenic
1167320317 19:48793689-48793711 CCCAGCATGTTGAGAGGCCGAGG + Intergenic
1167940041 19:52939423-52939445 CACATGAACTTGGGAGGTAGAGG - Intronic
1167988267 19:53336424-53336446 CACATGAACTTGGGAGGTAGAGG + Intronic
1168001916 19:53453623-53453645 CCCAGGACTTTGAGAGGTTGAGG + Intronic
1168629320 19:57944746-57944768 CCCAGGAGGTGGAGAGGTGGAGG + Intronic
925133473 2:1510659-1510681 CCCAGGAGGAAGAGAGGTAGTGG - Intronic
925994149 2:9278260-9278282 CCCAGCATGTTGGGAGGTTGAGG + Intronic
926202356 2:10811277-10811299 CCCAGGATTTTGGGAGGTTGAGG + Intronic
926426979 2:12746995-12747017 CACATGAGATTGATAGGTAGAGG + Intergenic
926439139 2:12869660-12869682 CCCAGGCTGTGAAGAGGTAGAGG + Intergenic
927330610 2:21858909-21858931 CAGAGGATGATGAGGGGAAGAGG + Intergenic
927453779 2:23231897-23231919 CACAGGCTGTTCAGATTTAGAGG + Intergenic
927985272 2:27405750-27405772 CACAGCATTTTGGGAGGCAGAGG + Intronic
928554202 2:32406139-32406161 CCCAGGACTTTGAGAGGTAGAGG + Intronic
928569004 2:32584120-32584142 CCCAGCATGTTGGGAGGTTGAGG + Intronic
928727822 2:34195515-34195537 CACAGGACTTTGGGAGGTTGAGG + Intergenic
929152594 2:38760739-38760761 CCCAGCATTTTGAGAGGCAGAGG - Intronic
929383882 2:41382396-41382418 TTCAGCTTGTTGAGAGGTAGCGG - Intergenic
930134804 2:47891072-47891094 CCCAGCATGTTGGGAGGCAGAGG - Intronic
930569392 2:53065837-53065859 CCCAGCATTTTGGGAGGTAGAGG + Intergenic
931793134 2:65683317-65683339 CCCAGCATTTTGGGAGGTAGAGG - Intergenic
933022982 2:77218242-77218264 CCCAGCATGTTGGGAGGCAGAGG - Intronic
933909284 2:86924865-86924887 CACAGCACTTTGAGGGGTAGGGG + Intronic
934023442 2:87978514-87978536 CACAGCACTTTGAGGGGTAGGGG - Intergenic
934717164 2:96550782-96550804 CACAGGGAGTTGTGGGGTAGGGG - Intronic
934845424 2:97658995-97659017 CACAGGATGCTGCGAGGGACGGG + Exonic
935028701 2:99301998-99302020 CACAGGGTGTGGTGAGGGAGGGG - Intronic
935029284 2:99306510-99306532 CACAGGGTGTGGTGAGGGAGGGG + Intronic
935280837 2:101516460-101516482 CCCAGCATGTTGAGAGGCTGAGG - Intergenic
935507947 2:103930993-103931015 CCCAGGATTTTGGGAGGTGGAGG - Intergenic
936232782 2:110718930-110718952 CCCAGCATTTTGAGAGGCAGAGG + Intergenic
936364103 2:111836243-111836265 CACAGCACTTTGAGGGGTAGGGG - Intronic
937374267 2:121324678-121324700 CCCAGGATTTTGCGAGGTTGAGG + Intergenic
938838093 2:135128898-135128920 CCCAGCATTTTGAGAGGTCGAGG + Intronic
938991259 2:136632328-136632350 CCAAGGATGTTGAGAGATAATGG - Intergenic
939181135 2:138803744-138803766 CACAGCACTTTGAGAGGTTGAGG + Intergenic
939746989 2:145985245-145985267 CACTGGATGTTGACTGGGAGGGG + Intergenic
940017315 2:149120873-149120895 CACCTGATCTTGGGAGGTAGAGG - Intronic
941996674 2:171607719-171607741 CACAGCATTTTGAGAGGCTGAGG + Intergenic
942280022 2:174352496-174352518 CCCAGCATTTTGAGAGGCAGAGG + Intronic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
944000332 2:194827609-194827631 CCCAGCATTTTGGGAGGTAGAGG + Intergenic
944806845 2:203290891-203290913 CCCAGCATGTTGAGAGGTGGAGG - Intronic
945758224 2:213877391-213877413 CACTTGATGTTGGGAGGTTGAGG - Intronic
945984033 2:216340117-216340139 AACAGGAAGTTGAGAGGGTGGGG + Intronic
946384708 2:219375803-219375825 CCCAGCACTTTGAGAGGTAGTGG - Intronic
946419966 2:219559181-219559203 GAGAGGAGGTAGAGAGGTAGGGG - Intronic
946656584 2:221954937-221954959 CACAGGATCATGAGAGGAAAAGG + Intergenic
946882068 2:224186237-224186259 TGCAGGATGGTGAGAGGAAGGGG + Intergenic
947062243 2:226180158-226180180 CACAACAAGTTGAGAGGAAGGGG - Intergenic
947228416 2:227861875-227861897 CCCAGCATTTTGGGAGGTAGAGG - Intergenic
947775568 2:232706391-232706413 CCCAGCATGTTGGGAGGTTGAGG + Intronic
948870297 2:240794478-240794500 CACACGATGTTGTGGGGAAGGGG - Intronic
1169147864 20:3265489-3265511 CCCAGGAGGTGGAGAGGTGGAGG + Intronic
1169186342 20:3620320-3620342 CCCAGGAGGTGGAGAGGTTGCGG - Intronic
1169251147 20:4062397-4062419 GACATGATTTTGAGAGGTGGAGG + Intergenic
1169484809 20:6019930-6019952 CCCAGCACTTTGAGAGGTAGAGG - Intronic
1171254253 20:23675271-23675293 CACAGTATTTTGAGAGGCTGAGG - Intergenic
1171260754 20:23730533-23730555 CACAGTATTTTGAGAGGCTGAGG - Intergenic
1171269876 20:23806394-23806416 CACAGTATTTTGAGAGGCTGAGG - Intergenic
1171527071 20:25822238-25822260 CTCAGGATTTTGAGAGGTTGAGG + Intronic
1171549756 20:26033646-26033668 CTCAGGATTTTGAGAGGTTGAGG - Intergenic
1172403248 20:34668210-34668232 CACAGCATTTTGGGAGGTCGAGG + Intronic
1172412750 20:34738151-34738173 CTCAGCATGTTGAGAGGCCGAGG - Intronic
1172691814 20:36795338-36795360 CCCAGCATTTTGAGAGGCAGAGG - Intronic
1173104829 20:40123965-40123987 GACAGGATGATTAGAGGCAGGGG - Intergenic
1174369911 20:50079595-50079617 CACAGCATGTTGGGAGGCCGAGG - Intergenic
1175271179 20:57735138-57735160 CACAGGAGCCTGAGAGGGAGGGG - Intergenic
1176006993 20:62870864-62870886 TACAGGAGGATGAGAGGAAGGGG - Intergenic
1176260551 20:64177509-64177531 CCCAGGGTGTGGAGAGGAAGAGG + Intronic
1176446044 21:6821314-6821336 TCCAGGATGTTGAGAGGCCGAGG - Intergenic
1176824210 21:13686347-13686369 TCCAGGATGTTGAGAGGCCGAGG - Intergenic
1177069617 21:16487188-16487210 CCCAGCATGTTGAGAGGCTGAGG - Intergenic
1177157008 21:17510738-17510760 CCCAGCATGTTGGGAGGCAGAGG - Intergenic
1177641645 21:23851004-23851026 CCCAGCATCTTGAGAGGTCGAGG + Intergenic
1179979276 21:44887981-44888003 CACAGGCTCCTGAGAGGCAGAGG - Intronic
1180434199 22:15284824-15284846 CACAGCATTTTGAGAGGCTGAGG - Intergenic
1180564134 22:16648945-16648967 CACATGCTGGTGAGAGGTGGTGG + Intergenic
1180628831 22:17213038-17213060 CCCAGAATGTCGGGAGGTAGAGG - Intronic
1180631727 22:17234514-17234536 CCCAGCACTTTGAGAGGTAGAGG + Intergenic
1181297521 22:21852588-21852610 CCCAGGATTTTGGGAGGTAGAGG + Intronic
1182026238 22:27121438-27121460 AGCAGGATGTTGAGAGATTGGGG - Intergenic
1182505091 22:30776373-30776395 CCCAGCATGTTGGGAGGCAGGGG - Intronic
1182621749 22:31622256-31622278 CACAGTGTGTGGAGAGGTGGTGG + Intronic
1182831744 22:33309808-33309830 CACAGGACGGTGAGGGGCAGGGG + Intronic
1183212401 22:36458920-36458942 CTCAGGAGGCTGAGAGGTAGGGG + Intergenic
1183759173 22:39799899-39799921 CCCAGGATGTGGAGATGCAGGGG + Intronic
1183807654 22:40225234-40225256 TACAGGATTTTGAGAGATGGAGG + Intronic
1184767944 22:46581735-46581757 CACAGGTTGCTGCGTGGTAGAGG + Intronic
950229243 3:11261584-11261606 CCCAGCATGTTGAGAGGCTGAGG + Exonic
950809881 3:15641165-15641187 CACAGGATGTTGCCAGGTGTGGG + Intronic
953435434 3:42874058-42874080 CACAGGAAGTCCAGAGGAAGGGG - Exonic
955418159 3:58711993-58712015 CACAGGAGCTTGAGAGGCTGCGG + Intergenic
956661837 3:71606285-71606307 CACTGGAGCCTGAGAGGTAGAGG + Intergenic
958676518 3:97274603-97274625 TTCAGCTTGTTGAGAGGTAGTGG + Intronic
961240776 3:125409292-125409314 TACAGGAAATTCAGAGGTAGAGG - Intergenic
961261285 3:125604239-125604261 CACAGCATTTTGGGAGGTTGAGG - Intergenic
961645438 3:128390412-128390434 CACTGTATTTTGGGAGGTAGAGG + Intronic
961961054 3:130855483-130855505 CAGAGGCTGTTGAGATCTAGGGG + Intronic
962035591 3:131648120-131648142 CACAGCATTTTCAGAGGCAGAGG + Intronic
962255349 3:133866656-133866678 CACATGAAGGTGAGAAGTAGGGG + Intronic
962878400 3:139553630-139553652 CTCAGGATGTTGTTAGGAAGGGG + Intergenic
963286282 3:143437415-143437437 CACAGGATGGCTAGAGGAAGTGG + Intronic
963510919 3:146247870-146247892 CACAGTACTTTGAGAGGCAGGGG - Intronic
964855298 3:161139887-161139909 CACAGGATGTTTACAGTTAAGGG + Intronic
965758457 3:172049775-172049797 CCCAGGACTTTGGGAGGTAGAGG - Intronic
965938452 3:174145262-174145284 CACAGCACTTTGAGAGGCAGAGG + Intronic
966406227 3:179601159-179601181 CCCAGGATGTTGGGAGGCTGAGG + Intronic
966440718 3:179941770-179941792 CCCAGGATTTTGTGAGGCAGAGG + Intronic
967295340 3:187958818-187958840 CACAGGAAAGTGAGAGGAAGTGG - Intergenic
967552566 3:190814961-190814983 CCCAGCATTTTGGGAGGTAGAGG + Intergenic
967801436 3:193666535-193666557 CTCAGCATGTTGAGAGGCCGAGG + Intronic
969395951 4:6921455-6921477 CCCAGCATTTTGGGAGGTAGAGG - Intronic
969401733 4:6960340-6960362 CCCAGCATGTTGGGAGGCAGGGG - Intronic
972067778 4:34972265-34972287 CCCAGGATGTTGGGAGGCCGAGG - Intergenic
972423835 4:38914312-38914334 CCCAGCATGTTGAGAGGCTGAGG + Intronic
972639999 4:40916764-40916786 CAGAGGATGTTGCGAGGCAATGG + Intronic
974774783 4:66465490-66465512 CCCAGCATTTTGAGAGGTCGAGG + Intergenic
975100153 4:70503638-70503660 CACAGCATTTTGAGAGGTTGAGG - Intergenic
975699220 4:77046170-77046192 CACAGTAAGTTGTGAGGAAGTGG + Intergenic
975818911 4:78249404-78249426 CACTTGAACTTGAGAGGTAGGGG - Intronic
976310755 4:83609968-83609990 CCCAGCATTTTGAGAGGTGGAGG + Intergenic
976821944 4:89216479-89216501 CCAAGAATGTTTAGAGGTAGGGG - Intergenic
978431865 4:108641056-108641078 CACAGCATTTTGAGAGGCCGAGG - Intergenic
978478537 4:109161086-109161108 CCCAGCATTTTGAGAGGTAAAGG - Intronic
979188088 4:117824119-117824141 CACAGGATGTTGGGGGTTGGGGG - Intergenic
979470829 4:121093869-121093891 CCCAGCATTTTGAGAGGTCGAGG + Intergenic
979546578 4:121946930-121946952 CACAGCAACTTGGGAGGTAGAGG + Intronic
979904854 4:126274985-126275007 CACAGCATTTAGAGAGGCAGAGG + Intergenic
980714730 4:136614725-136614747 TTCAGCTTGTTGAGAGGTAGTGG - Intergenic
981436668 4:144731668-144731690 CCCAGCATGTTGGGAGGTTGAGG - Intronic
982021919 4:151213392-151213414 CCCAGGATTTTGGGAGGTAGAGG + Intronic
982194098 4:152892056-152892078 CAGAGGATGGTGAGTGGTTGGGG - Intronic
982436385 4:155385945-155385967 CTCAGCAATTTGAGAGGTAGAGG + Intergenic
983640658 4:169941568-169941590 CACAGGATTTGGGTAGGTAGTGG - Intergenic
984085773 4:175309353-175309375 CACAGCACGTTGGGAAGTAGAGG - Intergenic
984540867 4:181035479-181035501 CCCAGCACGTTGAGAGGCAGAGG + Intergenic
984599781 4:181712896-181712918 CACAAGATGTTGGGATATAGAGG + Intergenic
985393278 4:189514395-189514417 CACAGGATGCAGAGCCGTAGGGG + Intergenic
986324014 5:6658072-6658094 CCCAGCATGTTGAGAGGCCGAGG + Intronic
987964942 5:24860337-24860359 CACAGCATTTTGGGAGGTTGAGG + Intergenic
988809658 5:34771982-34772004 CCTAGGAGGTTGAGAGGTTGAGG - Intronic
989255818 5:39364772-39364794 CACAGCATGTTGGGAGGCTGAGG + Intronic
989604511 5:43231065-43231087 CCCAGGATTTTGAGAGGCTGAGG + Intronic
990796448 5:59547128-59547150 CACAGAATAGTTAGAGGTAGAGG - Intronic
991127133 5:63081893-63081915 CATAGAATGTTAAGAGCTAGAGG - Intergenic
992304396 5:75421057-75421079 CCCAGCATTTTGAGAGGCAGAGG - Intronic
992446319 5:76837452-76837474 CACAGCATTTTGAGAGGCTGAGG - Intergenic
992801532 5:80300276-80300298 CACAGGATGGTGTGGGGGAGGGG + Intergenic
993196940 5:84761035-84761057 CCCAGCATTTTGAGAGGTCGAGG - Intergenic
994267006 5:97729248-97729270 CCCAGCATTTTGAGAGGTCGAGG + Intergenic
995460454 5:112398099-112398121 CACAGCATGTAGACAGGAAGAGG + Intronic
995640832 5:114255472-114255494 CAAAGGATGTAGAGAGGTAGCGG + Intergenic
996419219 5:123243145-123243167 CTCAGCATTTTGAGAGGTCGAGG + Intergenic
997039662 5:130236590-130236612 TAAAGGATATTGAGAGGAAGTGG + Intergenic
997273199 5:132558821-132558843 CCCAGGAGGTCGAGAGGTCGAGG + Intronic
997480703 5:134182596-134182618 CCCAGGAGGTGGAGAGGTTGCGG - Intronic
998113340 5:139518430-139518452 AACAGGATGATGACAGGAAGAGG + Intergenic
998155777 5:139786275-139786297 CACAGGAGGCAGAGAGGTGGGGG + Intergenic
998500485 5:142628258-142628280 CCCAGCATGTTGAGAGGCCGAGG + Intronic
998971216 5:147594582-147594604 CACAGCATTTTGAGAGGCTGAGG - Intronic
999356070 5:150932663-150932685 TCCAGCATGTTGGGAGGTAGAGG + Intergenic
999747038 5:154600479-154600501 CACAGGACTTTGAGAGGCCGAGG - Intergenic
1001902561 5:175444118-175444140 CACAGGCTCCTGAGAGGTCGCGG - Exonic
1002144927 5:177172706-177172728 CCCAGCATTTTGAGAGGTTGAGG + Intronic
1002639924 5:180625917-180625939 CACTGGATGCTGAGAGGCAGGGG + Exonic
1002690551 5:181046844-181046866 CCCAGGAAGTTGACAGGTAGGGG + Intronic
1003277774 6:4667021-4667043 AACAGGAGGTGGACAGGTAGAGG - Intergenic
1003416277 6:5911216-5911238 AACAGGTTGGTGTGAGGTAGAGG + Intergenic
1003667705 6:8127076-8127098 AACAGGAGGTTGACAGGTAGGGG - Intergenic
1004930996 6:20463168-20463190 CCCAGAATTTTGAGAGGCAGAGG - Intronic
1004977639 6:20985543-20985565 CACAGCATTTTGGGAGGCAGAGG - Intronic
1005061083 6:21777670-21777692 CCCAGCATTTTGAGAGGCAGGGG - Intergenic
1005742653 6:28806942-28806964 CCCAGCATGGTGAGAGGCAGAGG + Intergenic
1005751644 6:28888375-28888397 CACAGCATTTTGAGAGGCTGAGG - Intergenic
1006034399 6:31200239-31200261 CAGAAGAGGTTGAGAGGTTGGGG + Intronic
1006431846 6:34002049-34002071 CACGGGATGAAGAGAGCTAGAGG + Intergenic
1006549617 6:34810717-34810739 CACAGCACTTTGAGAGGTCGAGG - Intronic
1007083364 6:39124902-39124924 TACAGGGAGTTGAGATGTAGAGG - Intergenic
1007877341 6:45120332-45120354 CCCAGGATTTTGGGAGGTCGAGG + Intronic
1008033976 6:46726890-46726912 CCCAGCACTTTGAGAGGTAGAGG - Intronic
1008621114 6:53272385-53272407 CACAGCATTTTGGGAGGTCGAGG - Intronic
1008648350 6:53539234-53539256 CCCAGGATGAGGAGAGGTAAGGG - Intronic
1009841117 6:69075104-69075126 CACCTGATTTGGAGAGGTAGTGG + Intronic
1011044986 6:83071456-83071478 CCCAGCATTTTGAGAGGCAGAGG - Intronic
1013065622 6:106682386-106682408 CCCAGGAGGTTGAGAGGTTGAGG - Intergenic
1013342654 6:109230210-109230232 CAGAGGTTGTTGTGAGGAAGCGG + Intergenic
1013413077 6:109898750-109898772 CCCAGCATGTTGAGAGGCTGAGG - Intergenic
1014447196 6:121542290-121542312 CCCAGCATTTTGAGAGGTAGAGG - Intergenic
1015224180 6:130837443-130837465 CCCAGCATTTTGGGAGGTAGAGG - Intergenic
1015829103 6:137348330-137348352 CACAGCATTTTGAGAGGCTGAGG + Intergenic
1017479695 6:154839757-154839779 CCCAGCATGTTGGGAGGTGGAGG - Intronic
1018758065 6:166866738-166866760 CACAGGAATCTGGGAGGTAGAGG - Intronic
1019925857 7:4191444-4191466 CTCAGGATGGTGAGAGGTGAGGG - Intronic
1020142155 7:5618247-5618269 CCCAGCATTTTGAGAGGTCGAGG + Intergenic
1021912833 7:25403389-25403411 CAGGGGCTGGTGAGAGGTAGGGG - Intergenic
1022739309 7:33106424-33106446 CCCAGCATTTTGGGAGGTAGAGG - Intronic
1023568225 7:41545283-41545305 AACAGGATGTTTAGATATAGAGG + Intergenic
1024497145 7:50061448-50061470 CCCAGCATGTTGGGAGGTCGAGG + Intronic
1026290524 7:69001844-69001866 CCCAGCACTTTGAGAGGTAGAGG - Intergenic
1026332731 7:69366799-69366821 CCCAGCATTTTGAGAGGCAGAGG - Intergenic
1027486640 7:78769888-78769910 CACATGATGTTAAGAGGAAATGG - Intronic
1027715832 7:81668598-81668620 CTCAGTATGTTGGGAGGCAGAGG + Intergenic
1027937018 7:84619691-84619713 CTCAGGAGGTTGTGAGGTTGTGG - Intergenic
1028418955 7:90610957-90610979 GGCAGGATGTTGACAGGGAGTGG - Intronic
1028518887 7:91707349-91707371 CCCAGGATGTGGAGAGATAGGGG - Intronic
1029175180 7:98659461-98659483 CCCAGCATGTTGGGAGGTTGAGG + Intergenic
1031062425 7:117066904-117066926 CAGAGAATGGTGAGAGGAAGTGG - Intronic
1031590737 7:123589473-123589495 CAGGGGCTGTTGAGAGGTGGGGG - Intronic
1032039803 7:128549814-128549836 CACAGCACTTTGAGAGGCAGAGG - Intergenic
1032129988 7:129220072-129220094 CACAGCACTTTGAGAGGTTGAGG + Intergenic
1032269198 7:130388208-130388230 CACAGGATGTTGGAATGCAGGGG - Intergenic
1032832114 7:135638606-135638628 CACAGCATGCTGGAAGGTAGGGG - Exonic
1032840134 7:135706793-135706815 TTCAGCATGTTGACAGGTAGTGG - Intronic
1033010328 7:137615164-137615186 CAAAGGATGGTGAGAGGAAGGGG - Intronic
1033282854 7:140018019-140018041 CACAGGATGTTGAGAGGTAGAGG - Intronic
1033431310 7:141292267-141292289 CACAGTAGGTTGAGAAGGAGGGG - Intronic
1033843547 7:145404018-145404040 CACAGGTTGTTGAGTGCTTGTGG - Intergenic
1034078932 7:148258778-148258800 CCCAGCATGTTGGGAGGTTGAGG + Intronic
1034090626 7:148361056-148361078 CCCAGCATTTTGAGAGGTTGAGG - Intronic
1034238816 7:149593894-149593916 CACAGGATGAGGGGAGGAAGAGG - Intergenic
1034610944 7:152367691-152367713 CCCAGGATTTGGAGATGTAGTGG + Intronic
1035823884 8:2623739-2623761 CCCGGGATGTGGAGAGGCAGGGG - Intergenic
1036814950 8:11895086-11895108 CAGGGGATGTTGAGGGGTCGGGG + Intergenic
1037374007 8:18209140-18209162 CCCAGGATGTTGGGAGTTGGAGG - Intronic
1037914356 8:22763609-22763631 CACAGGGTGTTGTGAGGATGAGG + Intronic
1039082603 8:33747501-33747523 CCCAGTATTTTGGGAGGTAGAGG + Intergenic
1039318560 8:36401387-36401409 CCCAGCATGTTGGGAGGCAGAGG - Intergenic
1039490464 8:37943692-37943714 CCCAGCATGTTGGGAGGCAGAGG + Intergenic
1040500848 8:48003808-48003830 GACAGGATGTTGAAAGGTGGAGG + Intergenic
1041379359 8:57237168-57237190 CACAGGATTTTGGGAGGCAAAGG + Intergenic
1042230387 8:66548531-66548553 CCCAGCATTTTGAGAGGCAGAGG - Intergenic
1045118037 8:99004951-99004973 CCCAGCATTTTGGGAGGTAGAGG - Intergenic
1045963373 8:107995547-107995569 CAGAGGATGGTGATAAGTAGAGG - Intronic
1047285450 8:123483812-123483834 CACAGCATGTTGGGAGGTTGAGG + Intergenic
1047443580 8:124900288-124900310 CACAGGTATTTGAGAGGCAGTGG - Intergenic
1047561066 8:125988588-125988610 AACAGGAAGATGAGAGGAAGAGG + Intergenic
1049653662 8:143788428-143788450 CTCAGGAGGGTGAGAGGCAGCGG + Intergenic
1050198965 9:3121017-3121039 CACGGGCTGTTGAGGGGTGGGGG - Intergenic
1051912744 9:22173192-22173214 TACAGGCAGTTGAGATGTAGTGG + Intergenic
1052341003 9:27363993-27364015 CCCAGCATGTTGAGAGGCTGAGG - Intronic
1054853442 9:69872732-69872754 CCCAGCATGTTGAGAGGTTGAGG + Intronic
1055038267 9:71841425-71841447 CACAGGATGTGGGGAGGAATGGG - Intergenic
1055243675 9:74216501-74216523 CACAGGCAGTAGAGAGGCAGTGG - Intergenic
1055744203 9:79424877-79424899 CCCAGCATGTTGGGAGGTCGAGG - Intergenic
1056068994 9:82966453-82966475 GACAGGCTGGTGAGAGGAAGCGG + Intergenic
1058896250 9:109402992-109403014 CACTTGAGCTTGAGAGGTAGAGG + Intronic
1059194204 9:112355476-112355498 CAAAGGAAGTTCAGAAGTAGTGG + Intergenic
1059479899 9:114581171-114581193 GACAGGATGTTGAGAATTAATGG + Intergenic
1059575123 9:115479365-115479387 AACAGTGTGTTGAGAGGTAAAGG - Intergenic
1059994322 9:119893949-119893971 GACAGGATGATGAAAGGAAGGGG + Intergenic
1060015370 9:120081987-120082009 CACAGGGTGTTGAGGGCTAAGGG + Intergenic
1061625565 9:131838934-131838956 GACAGGGTGTGGAGAGGGAGAGG + Intergenic
1062292969 9:135805632-135805654 CACAGGATGTGGTGATGTGGTGG - Intergenic
1062603913 9:137334250-137334272 CCCAGGACTTTGAGAGGCAGAGG - Intronic
1203523149 Un_GL000213v1:63211-63233 TCCAGGATGTTGAGAGGCCGAGG + Intergenic
1185453622 X:296371-296393 CCCAGCACGTTGAGAGGTTGAGG - Intronic
1187468140 X:19543926-19543948 GACAGGATGTTGGGAGGCGGGGG + Intronic
1188141156 X:26553789-26553811 CACTGGATCCTGAGAGGCAGAGG - Intergenic
1188332730 X:28894245-28894267 TTCAGCTTGTTGAGAGGTAGTGG + Intronic
1188783897 X:34320612-34320634 CCCAGCATGTTGAGAGGCCGAGG + Intergenic
1188941745 X:36246502-36246524 CACAGGGTGGTGGGAGGGAGAGG + Intronic
1189223790 X:39395829-39395851 CACTGGCTGTTGAGGGTTAGAGG + Intergenic
1189343709 X:40224166-40224188 CTCAGGAGGCTGAGAGGCAGGGG + Intergenic
1189689238 X:43598775-43598797 CACTGGTTGTTCAGAGGCAGAGG - Intergenic
1190981881 X:55463641-55463663 CACATGATGATGAGAGGGAGAGG - Intergenic
1190986817 X:55509539-55509561 CACATGATGATGAGAGGGAGAGG + Intergenic
1192234398 X:69286507-69286529 CAGAGGCTGATGAGAGGCAGAGG - Intergenic
1192713354 X:73615377-73615399 GACAGGATCTTGGGGGGTAGTGG + Intronic
1194053051 X:89096085-89096107 CCCAGCACTTTGAGAGGTAGAGG - Intergenic
1194706481 X:97181319-97181341 CACAGTATGTTGGGAGGCCGAGG - Intronic
1194754207 X:97718189-97718211 CAAAGGAGGTGGAGAGGTGGTGG - Intergenic
1195179867 X:102347347-102347369 CACAGGGTGTGGAGAGGGTGAGG - Intergenic
1195596058 X:106691177-106691199 CTCAGCATTTTGGGAGGTAGAGG - Intergenic
1195914162 X:109919773-109919795 CACTGGAACTTGAGAGGTGGAGG - Intergenic
1196832650 X:119788281-119788303 CCCAGCATGTTGGGAGGCAGAGG + Intronic
1197052483 X:122076892-122076914 CACAGGAAGTAGTCAGGTAGTGG - Intergenic
1197756055 X:129995688-129995710 CCCAGCATTTTGAGAGGCAGAGG - Intronic
1197793374 X:130277581-130277603 TACAGGATTTGGACAGGTAGCGG - Intergenic
1197833459 X:130670206-130670228 CACAGGAGGGTGAAAGGGAGAGG + Intronic
1197955160 X:131938712-131938734 CCCAGCATTTTGAGAGGTTGAGG - Intergenic
1198274060 X:135084770-135084792 AAAAGGAAGTAGAGAGGTAGCGG - Intergenic
1198521452 X:137457149-137457171 CCCAGTATGTTGAGAGGCCGAGG - Intergenic
1199305800 X:146266262-146266284 CACAAGAAGTTGACAGGTACTGG + Intergenic
1200414044 Y:2889672-2889694 CCCAGGATTTTGGGAGGTTGAGG - Intronic
1201309388 Y:12582136-12582158 CCCAGGATGTTGGGAGGCTGAGG - Intergenic