ID: 1033283790

View in Genome Browser
Species Human (GRCh38)
Location 7:140023916-140023938
Sequence CCACCTGGCAGGTGACCTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 304}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033283790_1033283803 20 Left 1033283790 7:140023916-140023938 CCTCCAGGTCACCTGCCAGGTGG 0: 1
1: 0
2: 1
3: 37
4: 304
Right 1033283803 7:140023959-140023981 GGTGACCCTCCCAGGACAAGGGG 0: 1
1: 0
2: 3
3: 19
4: 268
1033283790_1033283798 -1 Left 1033283790 7:140023916-140023938 CCTCCAGGTCACCTGCCAGGTGG 0: 1
1: 0
2: 1
3: 37
4: 304
Right 1033283798 7:140023938-140023960 GATGCACTTCCTTGGGCAATGGG 0: 1
1: 0
2: 2
3: 7
4: 124
1033283790_1033283802 19 Left 1033283790 7:140023916-140023938 CCTCCAGGTCACCTGCCAGGTGG 0: 1
1: 0
2: 1
3: 37
4: 304
Right 1033283802 7:140023958-140023980 GGGTGACCCTCCCAGGACAAGGG 0: 1
1: 0
2: 2
3: 25
4: 210
1033283790_1033283801 18 Left 1033283790 7:140023916-140023938 CCTCCAGGTCACCTGCCAGGTGG 0: 1
1: 0
2: 1
3: 37
4: 304
Right 1033283801 7:140023957-140023979 TGGGTGACCCTCCCAGGACAAGG 0: 1
1: 0
2: 0
3: 31
4: 188
1033283790_1033283794 -9 Left 1033283790 7:140023916-140023938 CCTCCAGGTCACCTGCCAGGTGG 0: 1
1: 0
2: 1
3: 37
4: 304
Right 1033283794 7:140023930-140023952 GCCAGGTGGATGCACTTCCTTGG 0: 1
1: 0
2: 2
3: 15
4: 134
1033283790_1033283808 30 Left 1033283790 7:140023916-140023938 CCTCCAGGTCACCTGCCAGGTGG 0: 1
1: 0
2: 1
3: 37
4: 304
Right 1033283808 7:140023969-140023991 CCAGGACAAGGGGAACCAGCAGG 0: 1
1: 0
2: 2
3: 25
4: 316
1033283790_1033283800 12 Left 1033283790 7:140023916-140023938 CCTCCAGGTCACCTGCCAGGTGG 0: 1
1: 0
2: 1
3: 37
4: 304
Right 1033283800 7:140023951-140023973 GGGCAATGGGTGACCCTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 188
1033283790_1033283797 -2 Left 1033283790 7:140023916-140023938 CCTCCAGGTCACCTGCCAGGTGG 0: 1
1: 0
2: 1
3: 37
4: 304
Right 1033283797 7:140023937-140023959 GGATGCACTTCCTTGGGCAATGG 0: 1
1: 0
2: 0
3: 7
4: 130
1033283790_1033283796 -8 Left 1033283790 7:140023916-140023938 CCTCCAGGTCACCTGCCAGGTGG 0: 1
1: 0
2: 1
3: 37
4: 304
Right 1033283796 7:140023931-140023953 CCAGGTGGATGCACTTCCTTGGG 0: 1
1: 0
2: 0
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033283790 Original CRISPR CCACCTGGCAGGTGACCTGG AGG (reversed) Exonic
900465205 1:2822072-2822094 CCTCTTGGCAGGCGCCCTGGAGG + Intergenic
900497687 1:2983507-2983529 CCACCTGGCCCGGGCCCTGGAGG + Intergenic
900971314 1:5993635-5993657 CCTCCTGGCATTTGTCCTGGGGG + Intronic
901922626 1:12547857-12547879 CCACCTGGCATTTGCCCTGTGGG + Intergenic
902546585 1:17194194-17194216 CCACCTGGGAGGTGTCAAGGGGG + Intergenic
902988245 1:20168867-20168889 CCACCTCCCAGGTGGCCTGAGGG + Intronic
903187829 1:21639238-21639260 CCACCTGCCTGGTGACCCTGAGG - Intronic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
904277164 1:29392161-29392183 CCACCTGACAGGTGAGCTGAGGG - Intergenic
904326439 1:29729661-29729683 CTGCCTGGAAGGTGACCTGGGGG + Intergenic
904670422 1:32160747-32160769 CCACGTGGCAGGTCATTTGGGGG + Intronic
905321319 1:37119390-37119412 GCACCTGGCAGGGGAAATGGGGG + Intergenic
905544344 1:38785940-38785962 CCACCTGGAAGCTGACATGCTGG - Intergenic
907332474 1:53680036-53680058 CGACCTGGCACCTGACCTTGAGG - Intronic
907368064 1:53979009-53979031 CCAGGTGGAAGCTGACCTGGAGG + Intergenic
907799538 1:57751137-57751159 CTACCTGGGAGGTGGCCTAGTGG + Intronic
911042109 1:93599238-93599260 CCACCTGGCAGGAAACACGGGGG - Intronic
912556654 1:110521019-110521041 CTACCTGTCACTTGACCTGGGGG - Intergenic
917906581 1:179591757-179591779 CCACCTGCCACGTGCCCTCGGGG + Exonic
920183488 1:204146856-204146878 CCCTCTGGCAAGTGCCCTGGTGG - Intronic
920337833 1:205257096-205257118 CCATCTGGCAGGAGACAGGGAGG - Intronic
921394845 1:214657733-214657755 CTAGCTAGCAGGTGAGCTGGAGG + Intronic
921560949 1:216657670-216657692 CCACCTGCCAGGTGAGGTTGTGG + Intronic
922853009 1:228750150-228750172 CCATGTGGCTGGTGACATGGAGG - Intergenic
922924453 1:229336247-229336269 CCACCTGGCATATGAGCTAGGGG - Intronic
924384847 1:243490938-243490960 TCACCTGCCAGGAGACCTAGTGG - Intronic
924477705 1:244395939-244395961 CATCCTGGCAGGGGAACTGGTGG + Intergenic
924828938 1:247572584-247572606 GCATCTGGCAGGTGCCCTGCTGG - Intronic
1062935482 10:1382939-1382961 CCAGCTGGAAACTGACCTGGGGG + Intronic
1067060013 10:43073459-43073481 CCTCCTCGCAGCTGCCCTGGAGG + Intergenic
1067079617 10:43205714-43205736 CCAGCTAGCAGGTGGCCTGGGGG - Intronic
1067223349 10:44359710-44359732 CCCCCTGGCAGGACAGCTGGTGG + Intergenic
1068531285 10:58189562-58189584 TCAGCTGGCAGGTCATCTGGGGG - Intergenic
1069632120 10:69903299-69903321 CCACCTGCCAGCTGAGCTGAAGG + Intronic
1070086184 10:73239363-73239385 CGACCTGGCAGGGGATCTGCAGG + Exonic
1070548688 10:77473754-77473776 CCTGCAGGCAGGTGACCAGGAGG - Intronic
1070604555 10:77889613-77889635 CAGCCTAGCAGGTGACCTGCTGG - Intronic
1070746657 10:78937848-78937870 CCTCCTGGCGGGAGCCCTGGAGG - Intergenic
1070754447 10:78983008-78983030 CCACGTGACAGGTGCTCTGGAGG - Intergenic
1070858644 10:79630119-79630141 CCAGCTGCCAAGTGTCCTGGAGG + Intergenic
1070912899 10:80133489-80133511 CCACCTGGCAGGTGAATCGGTGG - Intronic
1071502240 10:86212234-86212256 CCCTCTGTCAGGTGCCCTGGAGG + Intronic
1071774009 10:88764403-88764425 ACAACTGGCCGGGGACCTGGTGG - Exonic
1072594489 10:96858836-96858858 CTGCCTGGCAGATGGCCTGGTGG + Intronic
1072743115 10:97922198-97922220 CCACCAGGCAGGAGTCCAGGTGG + Intronic
1072782298 10:98259170-98259192 TCCCCAGGCAGGTGACCTGGTGG + Exonic
1074467074 10:113692697-113692719 CTACCTCACAGGTGACCTTGTGG - Intronic
1075079716 10:119375239-119375261 CCTCCTGGCATCTCACCTGGAGG + Intronic
1075222915 10:120600415-120600437 CCACAAGGTTGGTGACCTGGAGG - Intergenic
1075960990 10:126567608-126567630 AGCCCTGGAAGGTGACCTGGAGG + Intronic
1076554480 10:131312386-131312408 CCACCTGCCTGGTGCCTTGGAGG - Intergenic
1076891925 10:133288967-133288989 CCACCGGGCAGGTGACGTCATGG + Exonic
1076903224 10:133350098-133350120 CCACCAGGCTGGTGACCAGGAGG - Exonic
1077108179 11:850813-850835 CCTCCAGGCAGGCGACCTGTCGG + Intronic
1077130155 11:968013-968035 GCACCTGCCAGGGGAGCTGGCGG + Intronic
1077155969 11:1090922-1090944 CCACGTGGCAGGGGGCCTGGGGG + Intergenic
1077515717 11:3000877-3000899 GCACTTGGCAGGAGGCCTGGTGG - Intergenic
1077550523 11:3198106-3198128 CCACCTGGCAGGAGAGGAGGAGG - Intergenic
1081488077 11:43547255-43547277 CCACCTGGGTGCTGACATGGAGG - Intergenic
1081679777 11:44994160-44994182 CCACCTGGAAGGTGAGCTGAGGG - Intergenic
1081861546 11:46335882-46335904 CCTCCTGGCAGGGGGACTGGGGG + Intronic
1083410831 11:62491245-62491267 CCACATGGAGGGTGAGCTGGAGG - Intronic
1083800092 11:65041532-65041554 CTACCTGGCCGGTGAGGTGGCGG + Exonic
1084863794 11:72039915-72039937 TCACCTGGCAGGTTACCCAGAGG + Intronic
1084979470 11:72821661-72821683 CCACCTGGTAGGCCATCTGGGGG - Exonic
1085230006 11:74958884-74958906 CAACCTGGCAGATGATCTGGAGG - Intronic
1089108165 11:116032481-116032503 TCACCTGGCAGCTGCCCTGTGGG - Intergenic
1090175749 11:124647847-124647869 CCACCTGGCAGATTGTCTGGTGG - Intronic
1090234773 11:125139335-125139357 CCACATGGCAGGTGAGCAGGCGG - Intergenic
1091224338 11:133948731-133948753 CCAGGTGCCAGGTTACCTGGAGG + Intronic
1093763039 12:22931803-22931825 CCACCTCACAGGTGTCGTGGTGG - Intergenic
1101765959 12:107699602-107699624 TGAGCTGGCAGGTGACCTGGAGG - Intronic
1101772069 12:107760953-107760975 CCACCTGCCAGCTGCGCTGGGGG + Exonic
1102950206 12:117026242-117026264 GGACCTGGCATGGGACCTGGAGG - Intronic
1102950233 12:117026339-117026361 GGACCTGGCATGGGACCTGGAGG - Intronic
1102950259 12:117026436-117026458 GGACCTGGCATGGGACCTGGAGG - Intronic
1103361491 12:120357016-120357038 CCACCTGCAATGAGACCTGGCGG + Exonic
1104080080 12:125422470-125422492 CCACATGCCAGGTGGCCTGCTGG - Intronic
1104091234 12:125519511-125519533 CCACCTGCCAGGTAATCTGCTGG - Exonic
1104224812 12:126821020-126821042 GGACCTGCTAGGTGACCTGGGGG + Intergenic
1104809531 12:131611966-131611988 CCACCTGGCCGCTGACATCGTGG + Intergenic
1104858578 12:131913187-131913209 TCCCCCTGCAGGTGACCTGGTGG + Exonic
1105342569 13:19541162-19541184 CCACCTGGCAAGAAACCTTGGGG - Intergenic
1107970767 13:45640557-45640579 CCATCTGGCAGGTGCCCTTCTGG - Intergenic
1113751657 13:112780713-112780735 CCACGTGGCAAGTCCCCTGGAGG - Intronic
1114046602 14:18881401-18881423 CCACGTGGCAGGTGAGTCGGTGG - Intergenic
1114117609 14:19638046-19638068 CCACGTGGCAGGTGAGTCGGTGG + Intergenic
1118429987 14:65708121-65708143 CCACATGTCAAGAGACCTGGTGG + Intronic
1118930258 14:70234461-70234483 CCACCTCCCAGGCCACCTGGGGG - Intergenic
1118988096 14:70774239-70774261 CCTCCTGGCTGGTGATCTTGAGG - Intronic
1121615251 14:95309638-95309660 CCACCTGGCTGGAGAACTCGGGG - Intronic
1122825490 14:104368553-104368575 CCTCCAGGCAGGTGCCCAGGCGG - Intergenic
1122965659 14:105124037-105124059 CCACCTGGCAGGTCAGTTGAGGG - Intergenic
1123149336 14:106166222-106166244 GCACATGTGAGGTGACCTGGGGG - Intergenic
1125569976 15:40709106-40709128 TCACCTGCCAGGTGAGCTGTTGG + Exonic
1125596826 15:40892896-40892918 GCAGATGGCAGGTGACCTGGGGG + Intergenic
1127393964 15:58528822-58528844 TCTTCTGGCAGCTGACCTGGAGG + Intronic
1127873363 15:63091246-63091268 CTCACTGGCAGATGACCTGGGGG + Intergenic
1128227017 15:66008977-66008999 CTGCCTGCCAGGTGAGCTGGAGG + Intronic
1128227621 15:66013156-66013178 CCACATGGAAGCTGAGCTGGAGG + Intronic
1128361429 15:66964484-66964506 GCACCTGGCAGGCGAGCAGGTGG - Intergenic
1129868276 15:78925200-78925222 GCACCTGGCAGGTGTCATGAAGG + Intronic
1129978675 15:79846350-79846372 CCTCCTGACAGCTGTCCTGGGGG + Intronic
1130234913 15:82124840-82124862 CCACGTGGTGGGTGCCCTGGGGG + Intergenic
1130321339 15:82844966-82844988 GCTCCTGCCAGGTGCCCTGGGGG + Intronic
1131416880 15:92267610-92267632 CCTCCTGGGAGGTGAGCTGGAGG - Intergenic
1131977581 15:97961252-97961274 CCACCTGGCAGGTGAGATCAGGG + Intronic
1132396928 15:101481198-101481220 CCAGGTGGCAGGGGGCCTGGGGG + Intronic
1132551744 16:556483-556505 CCAACTGGCAGGTGGGGTGGTGG - Intergenic
1132660204 16:1057851-1057873 CCACCTGGCGGGTGACACCGGGG - Intergenic
1132989329 16:2784998-2785020 ACACCTGGCAGGCGTCCTTGTGG + Exonic
1133597703 16:7309261-7309283 CCACATTTCAGGTGAGCTGGGGG + Intronic
1135585898 16:23670608-23670630 CCAGCTGGCTGGTCTCCTGGGGG + Exonic
1136580016 16:31145785-31145807 TCACCTGGCAGGTGTCCCTGCGG + Exonic
1136588553 16:31202927-31202949 CCACCTCGCAGGCCAGCTGGAGG - Exonic
1136680641 16:31960088-31960110 GGACGTGGGAGGTGACCTGGGGG + Intergenic
1136684007 16:31983630-31983652 CCACCTGGCAGGTGGACAAGAGG + Intergenic
1136784633 16:32927182-32927204 CCACCTGGCAGGTGGACAAGAGG + Intergenic
1136885150 16:33926624-33926646 CCACCTGGCAGGTGGACAAGAGG - Intergenic
1138417669 16:56880408-56880430 CCACCTGGGAGGAGACATCGGGG + Intronic
1138599889 16:58047960-58047982 CCACCTGCCCGGTGACCTCTGGG - Intergenic
1139478218 16:67213783-67213805 CCACCTGGGAGGTGGCTTAGAGG - Intronic
1141700551 16:85640195-85640217 CCACCGGGCTGGTGACAAGGAGG - Intronic
1141860411 16:86712432-86712454 CCAGCTGCCAGGTGCCCTCGTGG - Intergenic
1203087292 16_KI270728v1_random:1191188-1191210 CCACCTGGCAGGTGGACAAGAGG + Intergenic
1143078747 17:4366259-4366281 ACAGCTGGCAGGTGAGCAGGCGG - Exonic
1143713884 17:8753467-8753489 CTACCTGGCCAGTGACATGGAGG - Exonic
1144459740 17:15448754-15448776 CAACCGGGCAGGTGAGGTGGTGG - Intronic
1144948325 17:18981112-18981134 CCACCTGGGAGGTGAAGGGGAGG + Intronic
1145240918 17:21240754-21240776 CCTCCTGTCCGGTCACCTGGGGG - Exonic
1145297468 17:21602504-21602526 GCAGCTGGCAGGTGACCCAGCGG + Intergenic
1145366476 17:22270361-22270383 GCAGCTGGCAGGTGACCCAGTGG - Intergenic
1145796844 17:27660562-27660584 CCACCAGACAGGGCACCTGGAGG - Intergenic
1146827269 17:36033545-36033567 ACACCTGGCAGGTGCTCTGACGG + Intergenic
1147144933 17:38479333-38479355 CCACCTGGCAGGTGGACAAGAGG + Intronic
1147686293 17:42288592-42288614 CCACCAGGTGGGTGACCCGGTGG + Exonic
1148089197 17:45012801-45012823 GGACCTGGCAGGTGGGCTGGGGG + Intergenic
1148339498 17:46864873-46864895 GCTCCTGGAAGGTGTCCTGGAGG - Intronic
1149506236 17:57196195-57196217 CCAGCTGGCAGGTTGGCTGGGGG + Intergenic
1149681981 17:58513628-58513650 CCACCAGGGAGGGGACCCGGGGG + Intronic
1152100512 17:78299094-78299116 CCACCAGACAGGTGTGCTGGAGG - Intergenic
1152241654 17:79164208-79164230 CCACCTGGCAGGGGCGGTGGCGG + Intronic
1152877554 17:82795774-82795796 CCACGTGGCAGGTGCCTTGAAGG + Intronic
1153618472 18:6954800-6954822 AAGCCTGGCAGGTGAGCTGGAGG + Intronic
1153984612 18:10341147-10341169 CCACCTTGCAGGTGGGCTGGGGG + Intergenic
1155845553 18:30701345-30701367 CCAGCTGGCAGGTTGGCTGGGGG + Intergenic
1160537640 18:79603627-79603649 TCCCCAGGCAGGAGACCTGGAGG + Intergenic
1160609176 18:80072914-80072936 CCTCCTGGGAGGTGACCAGCAGG - Intronic
1161357195 19:3825698-3825720 CCACCTGGCAGCCCACGTGGTGG - Intronic
1161403192 19:4077996-4078018 CCACGTGGCAGGTGGGCTGCAGG - Intergenic
1162034689 19:7932592-7932614 CCGCCTGGGAGGGGTCCTGGGGG + Intronic
1162706018 19:12555468-12555490 CAAGCAGGCAGGTGAGCTGGAGG + Intronic
1163464035 19:17455775-17455797 CCAGCTGCCAGAGGACCTGGAGG - Exonic
1163654842 19:18539646-18539668 CCACCTGGCCCTTGACCGGGCGG + Exonic
1163667150 19:18608540-18608562 CCACCTGCCAGGGGACCCAGAGG + Intronic
1163691421 19:18740593-18740615 GCTCCTGGGAGGTGACCTGCAGG - Intronic
1163715021 19:18868445-18868467 GCCTCTGGCAGGTGGCCTGGAGG + Intergenic
1164628371 19:29744721-29744743 CCACCTGGCAGGTACCCGGTAGG - Intergenic
1164641644 19:29830647-29830669 CTACCTGGCAGGTAAACTTGTGG - Intergenic
1165321978 19:35091110-35091132 CCTCCTACCAGGTGAGCTGGGGG + Intergenic
1165348813 19:35265799-35265821 CAATCTGGAAGGTGACCAGGTGG + Intronic
1165876016 19:39007400-39007422 CCAGGTGGCAGGTGAGCAGGTGG + Intronic
1165881021 19:39043644-39043666 CTACCTGGCAGGTGAGCAGGAGG + Intergenic
1166294171 19:41880914-41880936 CATCCTGGTAGGTGCCCTGGAGG - Exonic
1166806228 19:45488910-45488932 CCACGCGGGAGGTGATCTGGTGG + Exonic
1166990485 19:46689865-46689887 GCACCTGGCAGGTGGGGTGGAGG - Intronic
1166990490 19:46689873-46689895 CCACCTGCCAGGTGCCCAGAAGG + Intronic
1167291965 19:48629449-48629471 CCACCTAGGCGCTGACCTGGTGG + Exonic
1167953780 19:53048120-53048142 TCACCTGTCAGGTAACCAGGTGG + Intronic
925129228 2:1482489-1482511 CCACCTGGGAGGTGAGCAGGAGG + Intronic
925731610 2:6922963-6922985 TCACCTGGCTGGTGATCTGGTGG + Intronic
926139430 2:10359548-10359570 CCACTTCCCAGGTGGCCTGGAGG + Intronic
926141622 2:10371493-10371515 CCACCTTGGCTGTGACCTGGGGG + Intronic
926339367 2:11892228-11892250 AAGCATGGCAGGTGACCTGGAGG - Intergenic
926526506 2:13987689-13987711 GCACCTGGTGCGTGACCTGGAGG + Intergenic
927472512 2:23386179-23386201 CGGCCGGGCAGGAGACCTGGAGG + Intronic
928450297 2:31372325-31372347 CCACCTGGCAGCGGACATGCAGG - Exonic
933774665 2:85764917-85764939 TCATCTGCCTGGTGACCTGGTGG - Intronic
934847625 2:97672408-97672430 CTGCCTGGCAGGTGACCAGGAGG + Intergenic
934849389 2:97687824-97687846 CTGCCTGGCAGGTGACCAGGAGG + Intergenic
936044619 2:109177030-109177052 CCACCTGCTGTGTGACCTGGTGG + Intronic
938266753 2:129933501-129933523 CCACCTGGCAGGTGAGTCGGTGG + Intergenic
938687226 2:133750611-133750633 CCACCTGACAGGTGACCAGCTGG + Intergenic
940885865 2:158988810-158988832 CGACCTGCCATGAGACCTGGAGG - Intronic
940986827 2:160059263-160059285 CAAACTGGTAGGTGGCCTGGAGG + Intronic
942004860 2:171687855-171687877 CCACCTGTCAGGTGACTGGATGG - Intronic
944131475 2:196352217-196352239 CCTCTTAGCAGGTGGCCTGGTGG - Intronic
944469896 2:200041737-200041759 GAAGCTGGCAGGAGACCTGGAGG - Intergenic
948260688 2:236602297-236602319 CCAGCTGCCAGGAGACCAGGTGG - Intergenic
948607688 2:239146583-239146605 CCGCCTGACTGATGACCTGGTGG - Intronic
1168898108 20:1337924-1337946 CCACCAGCCAGGCTACCTGGGGG - Intronic
1168936573 20:1670943-1670965 CCACCTCGCAGATGACCTGAAGG + Intergenic
1170146508 20:13181011-13181033 CCACCTTGGAGGTTACCTGTAGG + Intergenic
1171406911 20:24917879-24917901 CCACCAGGCAGGCCACGTGGAGG + Intergenic
1173660981 20:44733579-44733601 CCTCCTGGCAGGTGGCCTCTCGG - Intergenic
1173898707 20:46571185-46571207 CCACATGTCATGGGACCTGGTGG - Intronic
1174113511 20:48212177-48212199 CCTCCTGTCAGGAGGCCTGGTGG - Intergenic
1174582121 20:51579448-51579470 GCAGCTGGCGGGTCACCTGGGGG + Intergenic
1175414034 20:58789708-58789730 ACACCTGGGAAGTGACCTGAAGG + Intergenic
1176113756 20:63422321-63422343 TCACCTGGCAGGTCACGGGGTGG - Intronic
1176378030 21:6096460-6096482 GCACCTGGGAGGTGACTTGGAGG - Intergenic
1178589238 21:33895239-33895261 CTGCAGGGCAGGTGACCTGGAGG + Exonic
1179479923 21:41670509-41670531 TAACCTGGCAGATGACCTGCTGG - Intergenic
1179745443 21:43441786-43441808 GCACCTGGGAGGTGACTTGGAGG + Intergenic
1179779979 21:43693292-43693314 TGAGCTGGCAGGTGAGCTGGTGG - Exonic
1179914540 21:44467686-44467708 GGACCGGCCAGGTGACCTGGAGG + Intergenic
1179980288 21:44891981-44892003 TCACCTGGAAGGTGATCTGCAGG + Exonic
1180008678 21:45035210-45035232 TCCACAGGCAGGTGACCTGGAGG + Intergenic
1180200752 21:46222715-46222737 CCACGTGGCAAGTGATCAGGAGG + Exonic
1180465140 22:15604040-15604062 CCACGTGGCAGGTGAGTCGGTGG - Intergenic
1181325972 22:22046325-22046347 CCACATGGCTGGTGACCAGTTGG - Intergenic
1181463397 22:23098279-23098301 CCACTTGGGATGAGACCTGGAGG - Intronic
1181888656 22:26041852-26041874 CAACCTGGCAGATGACCTCCTGG + Intergenic
1182261861 22:29078856-29078878 CCACTTGGCAGGTTACCTTCTGG + Intronic
1183187269 22:36299406-36299428 CCACCTGGCAGGTGAGAGAGGGG - Intronic
1183269964 22:36855378-36855400 CGGCCTGGCAGGTAGCCTGGAGG - Intergenic
1183338705 22:37266193-37266215 CCATCTGGCATGTGACCCAGAGG + Intergenic
1184601041 22:45543555-45543577 CCAGGAGGAAGGTGACCTGGGGG - Intronic
1184737677 22:46408956-46408978 CCACCTAGCAGGTGCCTTGGTGG + Intronic
1184785389 22:46669129-46669151 CCACTTTGCAGGAGACATGGGGG - Intronic
1184901858 22:47451307-47451329 CCATCTGACAGCTGTCCTGGAGG + Intergenic
1185110620 22:48898223-48898245 CCATCTTGCAGGAGATCTGGGGG - Intergenic
1185247392 22:49780454-49780476 CCACCCAGCAGGAGGCCTGGCGG + Intronic
1185323653 22:50215291-50215313 CCACTTCACAGGTGACTTGGAGG + Intronic
950100469 3:10353494-10353516 CCACGCTGCAGGTGATCTGGAGG + Intronic
950252047 3:11474104-11474126 CCACCTGGCAGGTGATTTGCAGG + Intronic
950544258 3:13629412-13629434 CCAGCTGGAAGGCGACCTTGTGG - Intronic
950630142 3:14276758-14276780 CCAGCAGGCAGCTGACCTGAGGG + Intergenic
950678943 3:14571646-14571668 TCACCTGGCAGGGGAGCTGGAGG + Intergenic
950770592 3:15307771-15307793 CCACCAGGGAGGTGACCGTGAGG - Intronic
952718275 3:36504508-36504530 CCACTTGGATGGTGACCTGCAGG - Intronic
952920813 3:38282653-38282675 CCACCTGGCAGAGGACCTTTGGG + Intronic
953474365 3:43193481-43193503 CCAGCTGGCTGGTTCCCTGGTGG + Intergenic
953567579 3:44046072-44046094 GCACCTGGCAGGTCACCAGCAGG - Intergenic
954687187 3:52377312-52377334 CCTCCTGACAGGTGAGCTGTGGG - Intronic
955078017 3:55632117-55632139 CCACTGGGCAGATGAGCTGGAGG + Intronic
961158882 3:124705197-124705219 CAACCTGCCATCTGACCTGGAGG - Intronic
961369321 3:126419883-126419905 CCAGCTGGCAGGTTACCTGCAGG + Intronic
961633390 3:128317865-128317887 CCACCTGGCAGGGAACTGGGAGG - Intronic
964433151 3:156625627-156625649 ACACATGGCAGGTGGCATGGGGG - Intergenic
966787910 3:183636732-183636754 CCCCCTTGAAGGTGATCTGGAGG + Intronic
967102908 3:186230841-186230863 CCATCTGGGTGGGGACCTGGTGG + Intronic
967955886 3:194876903-194876925 CCACCTGGCTGGGGGCTTGGGGG + Intergenic
968393728 4:213788-213810 CTACCCGGGAGGAGACCTGGAGG - Intergenic
968441289 4:625764-625786 CCACCTGGCAGAGGTCCCGGAGG - Exonic
968764715 4:2462424-2462446 CCACCTGGCGGGCGACGCGGCGG - Exonic
969285449 4:6199770-6199792 CCACCTGGGCGGAGATCTGGGGG + Intronic
969291660 4:6243930-6243952 GCACCTGGGAGGGGTCCTGGAGG - Intergenic
969414095 4:7047635-7047657 TCACCTGGCAGGTGCCGTGTGGG + Intronic
969478833 4:7436217-7436239 CCACCTGGGGTATGACCTGGAGG - Intronic
969689930 4:8698774-8698796 CCCCCTGGCAGGGGAGCTGCTGG - Intergenic
971228069 4:24773308-24773330 CCAGGAGGCAGGAGACCTGGAGG - Intergenic
971332830 4:25696444-25696466 CTACCTGCCAGGTGATCTGCAGG - Intergenic
971487263 4:27172791-27172813 CCTCCTGGCAGGTGATGTGGTGG + Intergenic
973644002 4:52931987-52932009 CCACCTGGAAGGCTTCCTGGAGG + Intronic
976811391 4:89104715-89104737 CTACCTTGCAGGTGGCCAGGAGG + Intronic
976812007 4:89108411-89108433 CCACCTTGCAGGTGGCTGGGAGG + Intronic
977844937 4:101757485-101757507 CTAACTGGCAGTTGAACTGGTGG - Intronic
979831747 4:125314240-125314262 CCACCTTCCAGGTGACTAGGGGG - Intergenic
980100236 4:128535250-128535272 GCATCTGGCAGGTGCCCTGCTGG - Intergenic
985260041 4:188106593-188106615 TCTCCTGGCCGGTCACCTGGAGG - Intronic
985427355 4:189843778-189843800 GCACCTGGCAGGGCCCCTGGTGG - Intergenic
985678593 5:1244652-1244674 CCTACTGGCGGCTGACCTGGAGG + Exonic
985860118 5:2464272-2464294 CCTCCATGCAGGTGGCCTGGCGG + Intergenic
985879222 5:2625949-2625971 CCACTGGGGAGGTGACCTAGTGG + Intergenic
986187186 5:5455359-5455381 GTACCTGGCAGGTGAACTGAGGG - Intronic
990908695 5:60832149-60832171 CCACCACTCAGGTGACCTTGGGG + Intronic
990978575 5:61580833-61580855 CCAAGTGGCAGGTGGCCCGGCGG - Intergenic
992268717 5:75044121-75044143 CCACCTGCGAGGTGACCTTCAGG - Intergenic
993875842 5:93305848-93305870 CCACTTGGCAGGAGACCTGGAGG - Intergenic
994145805 5:96393588-96393610 CCACCTGACAGGTGAAGTTGAGG - Intronic
997816062 5:137018292-137018314 GGACCAGTCAGGTGACCTGGAGG + Intronic
998304145 5:141056269-141056291 CCACCTGGCTGTTTACCTGTTGG + Intergenic
999228676 5:150048635-150048657 CCACCTGTGAAGTGACGTGGGGG - Exonic
999266302 5:150269159-150269181 CCTCCTGCCTGGGGACCTGGGGG + Intronic
999771027 5:154775656-154775678 CCACCTGGCAGGTGAACTAACGG + Intronic
1001246947 5:170111864-170111886 CCACCTGGAAGGCTGCCTGGAGG + Intergenic
1003192349 6:3885792-3885814 CCACCTGCTGGGGGACCTGGAGG - Intergenic
1004306898 6:14509356-14509378 CCTCCTGCCAGATGACCTGATGG + Intergenic
1004546009 6:16598955-16598977 CTACCTTGCAGGTGCCCTTGGGG - Intronic
1005806246 6:29476624-29476646 TCACCTGGAAGGTGACCCTGAGG - Intergenic
1006451623 6:34108882-34108904 CTACCTGGGAGGGGACCTCGAGG - Intronic
1006622390 6:35374857-35374879 GCAACTGTCAGGTGACCAGGGGG - Intronic
1007734739 6:43973462-43973484 CCACCTGGGAGGTGAGCAGGAGG + Intergenic
1011374580 6:86675634-86675656 CTACCTGTCAGATGATCTGGAGG + Intergenic
1012492764 6:99800485-99800507 CCACATGGCAGGTTTCCTGTTGG + Intergenic
1013672702 6:112422137-112422159 CCATCTGGCAGGTGCCCTTCTGG + Intergenic
1018531773 6:164772085-164772107 ACGTATGGCAGGTGACCTGGGGG - Intergenic
1019210481 6:170400886-170400908 CTTCCTGGCACTTGACCTGGGGG - Intronic
1019301655 7:307240-307262 CCACATGGCAGGTGAGGTGGAGG - Intergenic
1019580521 7:1759696-1759718 CCACTCGGCAGGTGGCCAGGGGG - Intergenic
1019747670 7:2709633-2709655 GCTCGTGGCACGTGACCTGGGGG - Exonic
1019759921 7:2803375-2803397 CCACCTGCCACGGGACCTGCAGG - Intronic
1026572421 7:71542898-71542920 CCACCTGGCAGATGTGTTGGGGG + Intronic
1026577368 7:71583403-71583425 CTTCCTGGCAGGTGACATAGAGG - Intronic
1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG + Intronic
1027443457 7:78245617-78245639 CCAGCTGGGAGGTGAGGTGGTGG - Intronic
1029157740 7:98529180-98529202 CCACATGGCTGGGGGCCTGGGGG - Intergenic
1029384061 7:100232048-100232070 CCACCTGGCAGGGGGCGGGGTGG + Intronic
1029437942 7:100573180-100573202 CCACCTCCCAGGCCACCTGGGGG + Exonic
1032439152 7:131928564-131928586 CCACCTGGAAGAGGAGCTGGGGG + Intergenic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1033105430 7:138516990-138517012 CAACCTGGGAGGTGAGATGGTGG + Intronic
1033283790 7:140023916-140023938 CCACCTGGCAGGTGACCTGGAGG - Exonic
1034444788 7:151108303-151108325 ACACCAGGCCGGTGACATGGCGG - Intronic
1034517420 7:151591589-151591611 CCACCAGGCAGGTGTTTTGGAGG + Intronic
1034838496 7:154374194-154374216 CCACCTGCTGGGTGACCTTGGGG + Intronic
1037723819 8:21467042-21467064 CCACCTGCCCTGTGACCTCGGGG - Intergenic
1039000555 8:32974829-32974851 CCAGCTGGAAGGTCAGCTGGGGG + Intergenic
1040395930 8:47000124-47000146 AGTCCTGGCAGGTAACCTGGCGG - Intergenic
1041196742 8:55408618-55408640 CCACCTGCCAGGAGACCTCAGGG - Intronic
1041689003 8:60671257-60671279 CCATCTGGTGGGTTACCTGGGGG - Intergenic
1041878760 8:62721908-62721930 CCACCTGGCAAGTGTCCCTGTGG + Intronic
1043758375 8:84032220-84032242 CCACATTGCAGGTGACATGAAGG + Intergenic
1044759743 8:95505615-95505637 CCCCATGGCAGGTGAGCTGCTGG + Intergenic
1045947935 8:107817847-107817869 ATACCTGGCAGCTGACCTGGTGG - Intergenic
1047214681 8:122866591-122866613 CCACCTGGCAGATGTCAGGGGGG - Intronic
1047492880 8:125388815-125388837 CCACCTTGCAGCTGCCCTGGAGG - Intergenic
1047754100 8:127905363-127905385 CCACCTGTGTGGTGCCCTGGGGG + Intergenic
1048981269 8:139704261-139704283 CCAGCTGGCTGGGGACCAGGCGG - Intergenic
1049360429 8:142210207-142210229 CCACCTGGCAGGTGTCCATCTGG - Intergenic
1049933445 9:477892-477914 ATACCTGCCAGGTGCCCTGGTGG + Intronic
1056299847 9:85229541-85229563 TCACCTGGCAGGTTGGCTGGAGG + Intergenic
1056678603 9:88697538-88697560 CCAACCCGCAGGTGACCTCGAGG - Intergenic
1056827137 9:89884179-89884201 CCTCCTGGCAGGGAACCTGAAGG + Intergenic
1057195309 9:93113077-93113099 CTTCCTGGCAGATGACCTAGGGG + Exonic
1060048025 9:120356176-120356198 TCAGCTGGCAGGTGGGCTGGGGG - Intergenic
1060281334 9:122217449-122217471 CCACCTAGGAGATGAACTGGTGG + Intronic
1060602644 9:124888385-124888407 CCACCTTGTAGGTGACCTCGAGG - Exonic
1060918750 9:127406149-127406171 GCACATGCCAGGAGACCTGGAGG - Intronic
1062204988 9:135331346-135331368 GCACATGGCAGGTGTTCTGGGGG + Intergenic
1062447928 9:136603514-136603536 CCACATGCCAGGGGTCCTGGTGG + Intergenic
1185548670 X:966506-966528 CCACCAGGCAGGTGAGCTCAGGG - Intergenic
1185724481 X:2408414-2408436 CCTCCTGGCATGTGCCCTGGAGG + Intronic
1189383552 X:40518835-40518857 ACACATGGAAGGTCACCTGGAGG - Intergenic
1191080945 X:56508714-56508736 GCATCTGGCAGGTGCCCTGCTGG + Intergenic
1192050212 X:67717794-67717816 CCAACTGGCAGGAGCCCAGGAGG + Intronic
1192233958 X:69284599-69284621 CCACCTGGCACGTGCTTTGGGGG - Intergenic
1192977216 X:76299490-76299512 CCATCTGGCAGGTTCCCTGCTGG - Intergenic
1195536526 X:106014225-106014247 CCTGCTGGCAGGTGCCCTTGAGG + Intergenic
1201882458 Y:18841957-18841979 GCACCTGGCAGGTGCCCTCTGGG + Intergenic
1202330688 Y:23749297-23749319 GCACCTGGCAGGTGCCCCTGTGG + Intergenic
1202540081 Y:25920764-25920786 GCACCTGGCAGGTGCCCCTGTGG - Intergenic