ID: 1033285405

View in Genome Browser
Species Human (GRCh38)
Location 7:140037001-140037023
Sequence TAGGCGACTTTGGAGTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033285405_1033285413 9 Left 1033285405 7:140037001-140037023 CCCATCAACTCCAAAGTCGCCTA 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1033285413 7:140037033-140037055 TGGCAGCAGGCCAGGCGCGGTGG 0: 1
1: 4
2: 79
3: 682
4: 3701
1033285405_1033285412 6 Left 1033285405 7:140037001-140037023 CCCATCAACTCCAAAGTCGCCTA 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1033285412 7:140037030-140037052 AGATGGCAGCAGGCCAGGCGCGG 0: 1
1: 0
2: 11
3: 115
4: 1052
1033285405_1033285410 -4 Left 1033285405 7:140037001-140037023 CCCATCAACTCCAAAGTCGCCTA 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1033285410 7:140037020-140037042 CCTACAGAAAAGATGGCAGCAGG No data
1033285405_1033285411 1 Left 1033285405 7:140037001-140037023 CCCATCAACTCCAAAGTCGCCTA 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1033285411 7:140037025-140037047 AGAAAAGATGGCAGCAGGCCAGG 0: 1
1: 0
2: 9
3: 64
4: 652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033285405 Original CRISPR TAGGCGACTTTGGAGTTGAT GGG (reversed) Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909761374 1:79291546-79291568 TAGGCGTATTTGGATTTGGTAGG - Intergenic
920551750 1:206867462-206867484 TATGCGACTTTGGCATTGATTGG + Intronic
1072598137 10:96895136-96895158 TAGGTGACTTTGAAGTTAAAAGG - Intronic
1073418677 10:103406028-103406050 TAGTGGACATTGGTGTTGATGGG + Exonic
1073888714 10:108071747-108071769 AAGGCGAGTTTGGAGGTGATAGG - Intergenic
1075504481 10:123009569-123009591 TAAGGGACTTCGGAGTTGTTCGG + Intronic
1077634758 11:3834809-3834831 TAGGCGAGTATGGAGGTGATGGG + Intronic
1080174583 11:29346795-29346817 GAGACGACTTTGGAGTTGATAGG + Intergenic
1083671680 11:64303606-64303628 TAGGCAAATTGGGGGTTGATAGG + Intronic
1087926916 11:103929433-103929455 GAGGGCACTTTGGAGTTTATTGG - Intronic
1094208397 12:27864591-27864613 GAGGAAACTTTGGAGGTGATCGG - Intergenic
1096057087 12:48662688-48662710 TAGGCAACTATGGAGTGGAAAGG + Intronic
1098119071 12:67216283-67216305 TAGGCTACTTTAGATTGGATGGG + Intergenic
1098158333 12:67623305-67623327 TAGGCGCCTTTGGATTTCAGAGG + Intergenic
1098451526 12:70623602-70623624 TAGTGCACTATGGAGTTGATGGG - Intronic
1102599970 12:114022247-114022269 TAGGGGACTTCCGAGGTGATCGG - Intergenic
1102777543 12:115533619-115533641 TAGGCAACTCTGGAGTTTTTGGG + Intergenic
1103372377 12:120429519-120429541 CAGGCGACTTAGAAGTTAATGGG + Intergenic
1106223795 13:27770135-27770157 TTGGGGACTTTGGACTTGTTGGG + Intergenic
1107607154 13:42070566-42070588 TAGGCGACTTTGGTCTTGCACGG - Intronic
1120474846 14:84974235-84974257 TAGGCAAGTTTGGGGATGATTGG + Intergenic
1129754821 15:78091708-78091730 GAGGGGACTTTGGAGTAGATGGG - Intronic
1131846809 15:96497111-96497133 GAGGAGACATTGGAGTTGAGGGG + Intergenic
1134217675 16:12328801-12328823 TAGGCAAAGATGGAGTTGATTGG + Intronic
1140044294 16:71430496-71430518 AAGGTGACTTGGGAGTTCATAGG + Intergenic
1150247245 17:63685625-63685647 TAGGCATTTTTGGAATTGATGGG + Intronic
1158315394 18:56206838-56206860 TATGCTAATTTGGAGTTTATGGG - Intergenic
1159177280 18:64854285-64854307 TAAGCAACTTTGGAGATGAGTGG - Intergenic
1159704148 18:71665865-71665887 TAGGTGAATTTGGCCTTGATTGG + Intergenic
1161345910 19:3768610-3768632 TAGGGGACTCTGGAGTGGAGGGG + Intergenic
1162937234 19:13987316-13987338 AAGGTGACTTTGGAGGTGGTAGG - Intronic
927115870 2:19901643-19901665 GAGGCGACGTTGGGGTTGTTTGG - Intronic
933673620 2:85033100-85033122 TAGGTGAATTTGGAGTAGCTGGG - Intronic
943328197 2:186526582-186526604 TAGTCGTCTTTGGTGTTTATAGG + Intergenic
946779548 2:223178891-223178913 TATGCTAGTTTGGAGTTTATAGG + Intronic
1168973339 20:1945950-1945972 AAGGGCACTGTGGAGTTGATGGG - Intergenic
1172242519 20:33422934-33422956 TAGGGGACTGCGGAGGTGATGGG - Intronic
952896007 3:38079503-38079525 TAGGGGGCTTTGGAGGCGATCGG + Intronic
953475916 3:43205851-43205873 TAGGAGGCCTTGGAGTTGGTTGG + Intergenic
956951268 3:74286065-74286087 TATGCTAATTTGGATTTGATAGG + Intronic
959002688 3:100982748-100982770 TAGGGGAGTTTGGAGAGGATGGG + Intronic
969101202 4:4769472-4769494 AAGCCGGCTTTGGAGTGGATGGG + Intergenic
969500632 4:7550453-7550475 CAGGCGGCTTTGGTGGTGATCGG + Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
972142506 4:35977868-35977890 TAGCCAACTTTGGAGATGCTGGG - Intronic
981257739 4:142683093-142683115 AAGGAGACTTAGGAGTTCATGGG - Intronic
982124294 4:152171154-152171176 GAGGACACTTGGGAGTTGATGGG - Intergenic
983459970 4:168015620-168015642 TAGGCAACTTTTGAGCTGGTGGG + Intergenic
988373984 5:30409393-30409415 TATGCATATTTGGAGTTGATAGG + Intergenic
991452057 5:66762444-66762466 TGGGGGGATTTGGAGTTGATGGG + Intronic
996952675 5:129146859-129146881 TAGGGGTCTTTGGAATTGCTAGG + Intergenic
997823929 5:137089685-137089707 GATGGGACTTTGGAGTTGAGGGG - Intronic
1004573887 6:16873988-16874010 CAGGCCCCTTTGGAGTAGATTGG + Intergenic
1010375954 6:75170543-75170565 AAGCCGACTTTGAAGTTGAATGG - Intronic
1017908196 6:158771151-158771173 CAGGTGACTGTGGAGCTGATGGG - Intronic
1018967459 6:168499777-168499799 TAGGGGACTGTGGAGCAGATTGG + Intronic
1024656933 7:51458888-51458910 AAGGCCACTTTGGAATGGATGGG - Intergenic
1026662254 7:72312501-72312523 TGGGCCACTTTGCAGTTGAGGGG + Intronic
1026986891 7:74560302-74560324 TAGGCGAGGTTGGAGGTGAGTGG + Intronic
1027692672 7:81368032-81368054 TATAAGACATTGGAGTTGATAGG - Intergenic
1032884395 7:136122541-136122563 TGTGCGATTTTGGAGTTTATGGG + Intergenic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1035100125 7:156389493-156389515 CGGGCGGCTTTGGAGTTGGTCGG - Intergenic
1041799340 8:61782083-61782105 AAGGAAACTTTGGAGGTGATAGG - Intergenic
1042832253 8:73043915-73043937 TTGGAGACCATGGAGTTGATAGG + Intronic
1043932527 8:86107062-86107084 TAGACAACTGTGTAGTTGATAGG + Intronic
1047092389 8:121588477-121588499 TGGGTGAATTTGGAGCTGATAGG - Intergenic
1055492079 9:76815547-76815569 TAGGGGACTAGGGAGGTGATTGG - Intronic
1187119038 X:16385403-16385425 GAGGCCATTTTGGACTTGATTGG - Intergenic
1188964982 X:36539826-36539848 AAGTAGACTTTGGAGTTGTTTGG + Intergenic
1189137555 X:38564391-38564413 TGGGGGACATTTGAGTTGATTGG + Intronic
1193441790 X:81550058-81550080 TAGGAAACTTTTGAGATGATGGG - Intergenic
1196975804 X:121156320-121156342 TTTGCAACTTTTGAGTTGATTGG + Intergenic
1199161981 X:144623731-144623753 CAGGTGACTTTGACGTTGATGGG - Intergenic