ID: 1033285410

View in Genome Browser
Species Human (GRCh38)
Location 7:140037020-140037042
Sequence CCTACAGAAAAGATGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033285404_1033285410 4 Left 1033285404 7:140036993-140037015 CCGTTAAACCCATCAACTCCAAA 0: 1
1: 0
2: 0
3: 22
4: 357
Right 1033285410 7:140037020-140037042 CCTACAGAAAAGATGGCAGCAGG No data
1033285402_1033285410 12 Left 1033285402 7:140036985-140037007 CCTACCATCCGTTAAACCCATCA 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1033285410 7:140037020-140037042 CCTACAGAAAAGATGGCAGCAGG No data
1033285405_1033285410 -4 Left 1033285405 7:140037001-140037023 CCCATCAACTCCAAAGTCGCCTA 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1033285410 7:140037020-140037042 CCTACAGAAAAGATGGCAGCAGG No data
1033285406_1033285410 -5 Left 1033285406 7:140037002-140037024 CCATCAACTCCAAAGTCGCCTAC 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1033285410 7:140037020-140037042 CCTACAGAAAAGATGGCAGCAGG No data
1033285403_1033285410 8 Left 1033285403 7:140036989-140037011 CCATCCGTTAAACCCATCAACTC 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1033285410 7:140037020-140037042 CCTACAGAAAAGATGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033285410 Original CRISPR CCTACAGAAAAGATGGCAGC AGG Intronic
No off target data available for this crispr