ID: 1033285411

View in Genome Browser
Species Human (GRCh38)
Location 7:140037025-140037047
Sequence AGAAAAGATGGCAGCAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 726
Summary {0: 1, 1: 0, 2: 9, 3: 64, 4: 652}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033285405_1033285411 1 Left 1033285405 7:140037001-140037023 CCCATCAACTCCAAAGTCGCCTA 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1033285411 7:140037025-140037047 AGAAAAGATGGCAGCAGGCCAGG 0: 1
1: 0
2: 9
3: 64
4: 652
1033285404_1033285411 9 Left 1033285404 7:140036993-140037015 CCGTTAAACCCATCAACTCCAAA 0: 1
1: 0
2: 0
3: 22
4: 357
Right 1033285411 7:140037025-140037047 AGAAAAGATGGCAGCAGGCCAGG 0: 1
1: 0
2: 9
3: 64
4: 652
1033285406_1033285411 0 Left 1033285406 7:140037002-140037024 CCATCAACTCCAAAGTCGCCTAC 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1033285411 7:140037025-140037047 AGAAAAGATGGCAGCAGGCCAGG 0: 1
1: 0
2: 9
3: 64
4: 652
1033285403_1033285411 13 Left 1033285403 7:140036989-140037011 CCATCCGTTAAACCCATCAACTC 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1033285411 7:140037025-140037047 AGAAAAGATGGCAGCAGGCCAGG 0: 1
1: 0
2: 9
3: 64
4: 652
1033285407_1033285411 -9 Left 1033285407 7:140037011-140037033 CCAAAGTCGCCTACAGAAAAGAT 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1033285411 7:140037025-140037047 AGAAAAGATGGCAGCAGGCCAGG 0: 1
1: 0
2: 9
3: 64
4: 652
1033285402_1033285411 17 Left 1033285402 7:140036985-140037007 CCTACCATCCGTTAAACCCATCA 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1033285411 7:140037025-140037047 AGAAAAGATGGCAGCAGGCCAGG 0: 1
1: 0
2: 9
3: 64
4: 652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033285411 Original CRISPR AGAAAAGATGGCAGCAGGCC AGG Intronic
900604304 1:3516976-3516998 AGACAAGATGGGAGCTGTCCTGG + Intronic
900912997 1:5615333-5615355 AGATACAATGGCTGCAGGCCAGG + Intergenic
901190665 1:7408025-7408047 AGAAAGGTTGGAAGCAGGCCTGG + Intronic
901435624 1:9245720-9245742 AGGAAAGACAGCAGCAGGGCAGG + Intronic
901717981 1:11172138-11172160 AGGAAAGAGGGCAACAGGCTGGG + Intronic
902758165 1:18563066-18563088 AAAAATGATGACATCAGGCCAGG + Intergenic
902798161 1:18813039-18813061 AGAAAAGATTGCAGCCAGGCCGG + Intergenic
902893687 1:19463882-19463904 AGAAATGAGGACAGCAGGCCAGG + Intronic
903469092 1:23572969-23572991 GGGAGAGATGGCAGAAGGCCTGG + Intergenic
903586473 1:24419462-24419484 AGGAGAGATGGCATCTGGCCTGG + Exonic
903723754 1:25425586-25425608 TGAAAATTTGTCAGCAGGCCTGG + Intronic
904178358 1:28647576-28647598 AAAAAAAATGGGAACAGGCCGGG + Intergenic
904183424 1:28683522-28683544 TAAAAAGATGTCAACAGGCCGGG - Intronic
904482127 1:30800684-30800706 GGGAAAGATGGGTGCAGGCCTGG + Intergenic
906195723 1:43929699-43929721 AGAGTAGATTGCATCAGGCCAGG + Intronic
906201949 1:43966151-43966173 AGAAGAGATGGCAGCCAGACAGG - Intronic
906306249 1:44721566-44721588 AAAAAACATGACAGTAGGCCGGG + Intronic
906454231 1:45979988-45980010 CATAAAGATGGCAACAGGCCAGG + Intronic
906633441 1:47391472-47391494 AAAAAAGATGTCAGCAGGGCTGG - Intergenic
907179988 1:52561124-52561146 AGAGAAGATGGCTGGAGGCTGGG - Intergenic
907205078 1:52762875-52762897 AGAAAATATAGCAGAGGGCCAGG - Intronic
907234582 1:53033966-53033988 AGAAAGGATTGAAGGAGGCCGGG + Intronic
907330241 1:53666248-53666270 AGAAAAGATAGCTGCTGTCCAGG - Intronic
908237930 1:62165171-62165193 TGAAAAGAAGGCTGTAGGCCAGG - Intergenic
908482715 1:64558090-64558112 AGAGAAAATGGCAGAGGGCCTGG - Intronic
909495183 1:76270209-76270231 TGAAAAGTTGGCAACTGGCCAGG + Intronic
910206873 1:84756884-84756906 AGAAAAGATCCCAGGAGCCCTGG - Intergenic
910674943 1:89807295-89807317 AGAAGAGATACCAGAAGGCCAGG + Intronic
911048335 1:93648062-93648084 AGAAAAGATGGACCCAGGCGCGG - Intronic
912229090 1:107771546-107771568 AGAAAAGCTAACAACAGGCCGGG - Intronic
912379913 1:109241751-109241773 AGACAAGATGGAAGGAGGCAAGG - Intergenic
912421443 1:109544714-109544736 AGGATACAGGGCAGCAGGCCAGG + Exonic
912917657 1:113832471-113832493 AAAAAACATGACAACAGGCCAGG - Intronic
913228618 1:116722109-116722131 AGAATAGAATGCAGGAGGCCAGG + Intergenic
914323551 1:146588582-146588604 AGTATAGGTGGCAGGAGGCCTGG + Intergenic
914383964 1:147149241-147149263 AGAAAGGATGGCATAAGGCAGGG + Intergenic
915308897 1:154997396-154997418 GGAAAAGAAGGCGGTAGGCCAGG - Intergenic
915368219 1:155327037-155327059 AGATGAGATGGCACCAGGCAGGG + Exonic
916303736 1:163305373-163305395 AAAAAAGATTGCAGCAGGGATGG - Intronic
916419500 1:164623106-164623128 AAAAAAGATGGCAACTGGCCAGG - Intronic
916531352 1:165659607-165659629 AGAGAAGAAGGCAGCAGGGCAGG + Intronic
916787685 1:168098268-168098290 AGGAGAGAAGGAAGCAGGCCGGG + Intronic
917643408 1:177006092-177006114 AGGAAAGAAGACAGCAGCCCAGG - Intronic
917897394 1:179505059-179505081 GGAGAAGATGGTAGCAGTCCAGG - Intronic
918023604 1:180720096-180720118 AGAAAAGCAGGGAGCAGGGCCGG + Intronic
918262052 1:182805132-182805154 AGAAATGATTGTAGTAGGCCGGG + Intronic
918998122 1:191789305-191789327 AGAAATGAAGGCACCAGGCTAGG + Intergenic
919850235 1:201667530-201667552 GGAATAGATGGCAGGAGACCTGG - Intronic
919875687 1:201865501-201865523 AGAAAAGACAGCTGCAGGCCGGG - Intronic
921190561 1:212704425-212704447 GGAAATGACGGCAGCAGTCCAGG + Intergenic
921219793 1:212965209-212965231 ATAAAACCTGGCAGAAGGCCAGG - Intronic
921635930 1:217493166-217493188 AGATTAGAAGGAAGCAGGCCTGG - Intronic
921644387 1:217597031-217597053 ACAAAATATGTCAACAGGCCAGG + Intronic
922021936 1:221714489-221714511 AGACAAGATGGCGCCAGGCAAGG + Intronic
922305690 1:224342195-224342217 TAAAAAAATGGAAGCAGGCCAGG - Intergenic
923750646 1:236743302-236743324 AGAAAACATGGAAGGAGGCCAGG - Intronic
923799709 1:237195560-237195582 AGAAAAGATTGAAGGAGGCCTGG - Intronic
923991342 1:239440325-239440347 AGAAAAGAAGTCAAGAGGCCAGG + Intronic
924264361 1:242266819-242266841 AGAAAAGAGAGAAGCTGGCCGGG + Intronic
924421237 1:243912098-243912120 AGAAAAGATGGGAACTGGCTGGG + Intergenic
924567507 1:245210830-245210852 AGAAAAAATGACAGAAGACCTGG - Intronic
924763599 1:247011144-247011166 AGAAAATGTGGCATCTGGCCAGG - Intergenic
1062792112 10:314361-314383 AGGAAAGATGGGAAGAGGCCAGG - Intronic
1063044639 10:2379373-2379395 ACAGAAGATGGCAGCAGGTGGGG - Intergenic
1063262568 10:4406875-4406897 AAAAAAGATTCCATCAGGCCTGG + Intergenic
1063381203 10:5587427-5587449 AGGAAATTTGGCAGCAGGCATGG + Intergenic
1063433510 10:6011834-6011856 GGAAAAGAGCGCATCAGGCCTGG - Exonic
1063653691 10:7965533-7965555 AACAAAGATGGCAGCATGGCTGG - Exonic
1063844686 10:10113157-10113179 AGAAAGGATGTCAGGAGGCTGGG - Intergenic
1064123472 10:12638947-12638969 AGAAAGGAAGACAGCAAGCCAGG - Intronic
1064490981 10:15856905-15856927 AGAGACAATGGCAGCAGTCCAGG - Intronic
1067184709 10:44016709-44016731 AGCAAAGATGGGAGCAGGTTAGG - Intergenic
1067778750 10:49182372-49182394 TGAAAAGATGGCAGAGGCCCGGG - Intronic
1068247498 10:54391645-54391667 AGAAAAGAAGGCAGCCAGCTTGG + Intronic
1069381628 10:67848417-67848439 AAAAAAGCAAGCAGCAGGCCGGG + Intergenic
1069689780 10:70342757-70342779 AGATGAGATGGAAGCTGGCCTGG - Intronic
1069690927 10:70351516-70351538 AGAAGAGAGGGCAGCAGGACTGG - Intronic
1070022936 10:72604566-72604588 AAAAAAAAAGGCAGAAGGCCGGG - Intronic
1070105243 10:73425377-73425399 AGAAAAGTTGTCATCAGGCTGGG + Intronic
1070140725 10:73735119-73735141 AGCAGAGAGGGCAGCTGGCCGGG - Intergenic
1070657158 10:78279510-78279532 ATAAAAGAAGTCACCAGGCCAGG - Intergenic
1071271799 10:84014382-84014404 AGAAAAGATGGCTGGGGTCCTGG - Intergenic
1072033462 10:91542741-91542763 CGACAAGATGGCAAGAGGCCAGG + Intergenic
1072049583 10:91690006-91690028 AGAAAAGAGCACTGCAGGCCTGG - Intergenic
1072612160 10:97024972-97024994 AAAAAATATGGGTGCAGGCCAGG + Intronic
1073306961 10:102510500-102510522 AATATAGATGGTAGCAGGCCGGG - Intronic
1073327280 10:102650233-102650255 ATCAAAAATGGCAGCTGGCCTGG + Intronic
1073433873 10:103504284-103504306 AGAAAACATGACAACAGGCCAGG - Intronic
1073462533 10:103674524-103674546 AAAAAACATGGCACCAGGCTGGG + Intronic
1074065528 10:110008923-110008945 AGCGAAGTTGGCAGCAGGTCTGG + Intronic
1074119346 10:110481832-110481854 AGCAAGGAGGGCAGCAGGGCTGG - Intergenic
1074420050 10:113300464-113300486 AGAAAACAGGGAAGCAGGCAAGG - Intergenic
1075078461 10:119367403-119367425 AGCAAAGATGGAAGGAGGCTTGG + Intronic
1075301654 10:121330037-121330059 AGAAAATATGATCGCAGGCCAGG - Intergenic
1075440016 10:122472688-122472710 AGAAATGATGGAATTAGGCCAGG - Intronic
1075733616 10:124651087-124651109 AGCAAAGGTGGCAGCAAGGCAGG + Intronic
1075965193 10:126605258-126605280 AGGAAAGATGGAAGCAGGAAGGG + Intronic
1076273184 10:129174538-129174560 TGGGCAGATGGCAGCAGGCCTGG - Intergenic
1076364579 10:129913819-129913841 TGAGAAGATGGCACCTGGCCTGG - Intronic
1076682236 10:132179077-132179099 ACAGGAGATGGCAGCATGCCTGG - Intronic
1076804136 10:132846813-132846835 AGAGAAGCAGGCCGCAGGCCAGG - Intronic
1077014595 11:394016-394038 AGAAAAGGAGGCGGGAGGCCAGG + Intronic
1077254889 11:1576305-1576327 ATAAAAAACTGCAGCAGGCCGGG + Intergenic
1077698068 11:4413205-4413227 AGGGAAGATGACAGAAGGCCAGG + Intergenic
1077895699 11:6451576-6451598 ATCAAACATGGCAGCAGGTCTGG + Intronic
1078229609 11:9427553-9427575 AGAAAAGATGAAAGACGGCCGGG - Intronic
1078237267 11:9497053-9497075 AGAATGGAAGTCAGCAGGCCTGG - Intronic
1078424641 11:11239113-11239135 AGAAGAGGTGGCAGAAGGTCAGG + Intergenic
1078672283 11:13376258-13376280 GGAAAAGTGGGGAGCAGGCCTGG - Intronic
1079207787 11:18431843-18431865 AGAAAAGAAGAGAGCAGGCCGGG - Intronic
1079212818 11:18478317-18478339 AGCAAACATGGCAGGAGGCTGGG + Intronic
1079328538 11:19514812-19514834 AGAAGAGATGGCTGCAGCCCAGG + Intronic
1079644144 11:22842794-22842816 AGAAAAGAAAGCAGCAGGGGAGG - Intergenic
1080283014 11:30580415-30580437 GCAAAAGATGGAAGCAGGCATGG + Exonic
1080337524 11:31215497-31215519 AAAAATGGAGGCAGCAGGCCTGG + Intronic
1081197342 11:40177523-40177545 AGAATAGGTGGGAGCATGCCTGG - Intronic
1081620204 11:44614908-44614930 AGAACAGAGGACAGAAGGCCTGG + Intronic
1081878460 11:46427711-46427733 ATAAAAAATGGTAACAGGCCGGG + Intronic
1082066655 11:47906272-47906294 AAAACAGGTGGCAGCAGGCTGGG + Intergenic
1083316054 11:61815694-61815716 AGAAAGGGAAGCAGCAGGCCTGG + Intronic
1083406759 11:62462833-62462855 AGAAGAGTTGGCTTCAGGCCGGG + Intronic
1084682106 11:70672461-70672483 AGAGAGGATGGCAGCATGGCTGG - Intronic
1084692080 11:70733500-70733522 ACAAAAGCAGGCAGCAGCCCTGG - Intronic
1084863878 11:72040405-72040427 ACAATACATGGCTGCAGGCCTGG - Intronic
1085387643 11:76166175-76166197 TTAAAAGATGGCATGAGGCCAGG - Intergenic
1085432106 11:76461939-76461961 AGAAAAGAAAACACCAGGCCAGG + Intronic
1085636904 11:78165983-78166005 AGACAAGATGGCACCAGCCAAGG - Intergenic
1085833713 11:79930332-79930354 AGAACAAATGGCAGGAGGTCTGG + Intergenic
1086009546 11:82083874-82083896 AGAAATGGTGGCAGTAGCCCAGG + Intergenic
1086856114 11:91868071-91868093 AGGAATGAAGGCAGCAGGGCTGG - Intergenic
1086944190 11:92828856-92828878 TGAAGAGAAGGCTGCAGGCCTGG + Intronic
1086964628 11:93015033-93015055 AGAGAAGATGGCACAAGTCCAGG - Intergenic
1088396670 11:109377090-109377112 AGAAAGGATGGAAGCTGGCTTGG - Intergenic
1088568444 11:111197542-111197564 TTAAAAGCTGTCAGCAGGCCAGG + Intergenic
1088603831 11:111510203-111510225 AGAAAAGGTGGAGACAGGCCGGG - Intronic
1088721141 11:112592929-112592951 AGTTAAGATGACAGCAGCCCTGG - Intergenic
1089029933 11:115315304-115315326 AGAAAAGATGGCAAAAGGACAGG + Intronic
1089090416 11:115869825-115869847 TGAAAAAATGGAACCAGGCCAGG + Intergenic
1089407448 11:118210023-118210045 AGAAAAGAAATAAGCAGGCCAGG - Intronic
1091100243 11:132865475-132865497 AGAAGTGATGGTAGCTGGCCAGG - Intronic
1091707758 12:2710805-2710827 GGAAAAGGTGGCTGAAGGCCAGG - Intergenic
1092205111 12:6610030-6610052 AAAAAAGAAGTCAGCAGTCCAGG + Intergenic
1092266865 12:6988266-6988288 TAAAAAGAATGCAGCAGGCCAGG + Exonic
1092456181 12:8644890-8644912 AACAAAGATGGCACCAGACCAGG - Intronic
1092800562 12:12161564-12161586 ATAAAAGAAGTCAACAGGCCGGG - Intronic
1093322154 12:17724838-17724860 AGAAAAGAGGGAAACAGGTCGGG + Intergenic
1094145043 12:27219857-27219879 TGAAATGATGGCATCAGGCTGGG - Intergenic
1094621890 12:32087842-32087864 ACAAAAGATGGGAGCAGGAGAGG - Intergenic
1095203418 12:39411830-39411852 AAAAAAATTAGCAGCAGGCCAGG - Intronic
1095696078 12:45145419-45145441 AGAGAAGATGGCAGGAGAGCTGG + Intergenic
1096437683 12:51608303-51608325 AGAAAAATTGGTACCAGGCCAGG - Intronic
1096676430 12:53228867-53228889 AGAAAAGGAGGCAGAATGCCCGG - Intronic
1097083840 12:56453226-56453248 AGAAAAGATGGCAGCTCTCAGGG - Intronic
1097286769 12:57884133-57884155 ATTAAAAATGACAGCAGGCCGGG + Intergenic
1099247642 12:80213416-80213438 AGATAAGAGGTCAGCAGGACTGG - Intronic
1099787627 12:87286907-87286929 GGAAAACAAGGCAGCTGGCCAGG - Intergenic
1100347229 12:93744184-93744206 AGTAAAGGGAGCAGCAGGCCTGG + Intronic
1100759753 12:97794387-97794409 AGAAAAGGTGGAAGCAGGACGGG + Intergenic
1102019896 12:109675072-109675094 AAAAATGCTGGCTGCAGGCCAGG - Intergenic
1102296549 12:111741345-111741367 AGAAAACTTGGCAGCCGGCTAGG - Intronic
1102422565 12:112815516-112815538 TTAAAAAATGGCAGCAGTCCTGG - Intronic
1102574967 12:113850438-113850460 AGAAAAGGCGGCAGGAGGCCAGG - Intronic
1103303596 12:119946748-119946770 AGCAAAAATAGCAGCATGCCTGG - Intergenic
1103767077 12:123287910-123287932 AGAAATAATGGCCGAAGGCCGGG - Intergenic
1103868559 12:124073829-124073851 AGAAAGGAGGTCAGCAGGACTGG - Intronic
1105009665 12:132747139-132747161 AGAAAAGGTGACAGCAATCCTGG - Intronic
1105284634 13:18994150-18994172 AGGCAAGAAGGCAGAAGGCCAGG + Intergenic
1105284991 13:18996287-18996309 AGACCAGAGGGCAGAAGGCCAGG + Intergenic
1105568260 13:21573565-21573587 ACATAAGATGGCAGCAAGCTGGG - Intronic
1106286537 13:28322895-28322917 AGAAAAAATGGAGCCAGGCCTGG - Exonic
1106622333 13:31382705-31382727 ACAAAAGAGGGCAAGAGGCCGGG - Intergenic
1107048727 13:36024187-36024209 AGAAATGAGGAGAGCAGGCCAGG - Intronic
1107621265 13:42232899-42232921 AGGGAAGATGGCTTCAGGCCAGG + Intronic
1109018605 13:57054477-57054499 AGAAACCCTGGCAGGAGGCCTGG - Intergenic
1110616716 13:77549993-77550015 AAAAAAACTGGCAGCAGGCCAGG - Intronic
1111100436 13:83577875-83577897 AAAAAAGAAGGAAACAGGCCGGG + Intergenic
1112470241 13:99681879-99681901 AGAAAAGATGCAAGGAGGCAGGG - Intronic
1112566211 13:100553041-100553063 AGAAAGCATGCCAGCAGGCAGGG + Intronic
1113272217 13:108686049-108686071 AGAGAAGAAAGCAGCAGACCTGG + Intronic
1113431080 13:110251002-110251024 ACAAAGGATGGGAGCAGGGCTGG - Intronic
1113576427 13:111398291-111398313 AAAAAAGCAGGCAGGAGGCCAGG - Intergenic
1114163383 14:20193538-20193560 ACAAAAATAGGCAGCAGGCCAGG - Intergenic
1114429003 14:22644553-22644575 AGGAAAGATGGTAGCAGGAGAGG - Intergenic
1115163758 14:30424834-30424856 AGAACAGACAGCAGCAGGGCAGG + Intergenic
1117142560 14:52804546-52804568 AAAAAAAAAAGCAGCAGGCCAGG + Intergenic
1117457457 14:55912361-55912383 AGAAAAGTTGGCAGCAGGCTGGG + Intergenic
1118554827 14:67006385-67006407 AGAAAAAATAGCAGCAAGCTGGG - Intronic
1118774967 14:68968088-68968110 GGAAAAGAGGGCAGCAGGCAAGG + Intronic
1119949818 14:78733198-78733220 AGAAAATAGTGCAGCAGGCATGG - Intronic
1120716491 14:87846423-87846445 AGAAAGGAGGTCAGCAGGGCAGG + Intronic
1120804291 14:88729385-88729407 ACAAAAATAGGCAGCAGGCCTGG - Intronic
1120996214 14:90420492-90420514 AAAAAAAAAGGCATCAGGCCGGG - Intergenic
1121233198 14:92373337-92373359 AGAAATGACAGCAGCTGGCCAGG - Intronic
1121737088 14:96226072-96226094 AGAAAGGAAGGCTGCAGGTCTGG - Intronic
1121885435 14:97538628-97538650 AGAGAAGATAGCAGGAGGCATGG - Intergenic
1122053651 14:99077608-99077630 AGCAATGATGACAGCAGGCATGG - Intergenic
1122334389 14:100960330-100960352 AGAACAGATGGCAGCATGCCTGG - Intergenic
1122941797 14:104984820-104984842 AGGGCAGATGGCAGAAGGCCTGG + Intergenic
1123109753 14:105860537-105860559 ACAAAAGATGGAAGCCAGCCTGG - Intergenic
1123159550 14:106264654-106264676 AGAAAAGTGTGCAGGAGGCCGGG - Intergenic
1123190590 14:106565636-106565658 AGAAAAGCGCGCAGGAGGCCGGG - Intergenic
1202870970 14_GL000225v1_random:163242-163264 ATAAAAGATGTCCACAGGCCGGG - Intergenic
1123694102 15:22864447-22864469 ATAACAGAGGACAGCAGGCCGGG - Intronic
1125266270 15:37885043-37885065 AGAAAAGAAGGCAGCAGCCCAGG - Intergenic
1125349083 15:38748856-38748878 AGAACAGTGGCCAGCAGGCCAGG - Intergenic
1125716517 15:41822727-41822749 AGAGGAGAGGGCAGCAGCCCTGG - Intronic
1125832322 15:42725695-42725717 TTAAAAGATGGGGGCAGGCCGGG + Intronic
1126100880 15:45117559-45117581 CCAAAAGATGGAAGAAGGCCCGG + Exonic
1126352543 15:47759568-47759590 GCAAAAGATGGCAACATGCCAGG - Intronic
1126755619 15:51922542-51922564 TGAAAATATGGCATCTGGCCGGG - Intronic
1127325838 15:57894534-57894556 AGAAAAGTTGGCAGCAGCTTTGG + Intergenic
1127409253 15:58689188-58689210 AGAAATAATGCAAGCAGGCCGGG + Intronic
1127688988 15:61376113-61376135 AGAAAAGGTGGAGGCTGGCCTGG + Intergenic
1128526552 15:68416056-68416078 AGAAGAGAGGGAGGCAGGCCAGG - Intronic
1128661819 15:69506893-69506915 AGAAAAGATGAGAAGAGGCCGGG - Intergenic
1128703470 15:69821387-69821409 AGAAAAGAAGGCACCAGACTAGG + Intergenic
1128949839 15:71866761-71866783 AAAAAAGATCAAAGCAGGCCAGG + Intronic
1128997475 15:72307336-72307358 GGAAATGCTGGCAGCATGCCTGG - Intronic
1130987545 15:88854624-88854646 AGAAAAGAAGGCAGAAGGACAGG - Intronic
1131236485 15:90701421-90701443 AGAACAGATGACAGCAGGTCAGG + Intergenic
1131521519 15:93119604-93119626 AGCAGAGATGGGAGCAGGCTGGG + Intergenic
1131632379 15:94193098-94193120 ATAAAAAATAGCATCAGGCCGGG + Intergenic
1131998376 15:98155255-98155277 AGGAAAGAGGGCAGCTGGCAGGG + Intergenic
1132685524 16:1160490-1160512 AGGAGAGCTGGCAGCAGGTCTGG + Intronic
1132789384 16:1677145-1677167 AGAAAACAAGGAAGGAGGCCGGG + Exonic
1132865013 16:2088996-2089018 AGACCTGATGCCAGCAGGCCTGG + Exonic
1133684961 16:8157743-8157765 GGAAAAGAAGGCACCAGGCCAGG - Intergenic
1134003888 16:10804450-10804472 CCAAAAGAAGCCAGCAGGCCGGG + Intronic
1134060527 16:11197084-11197106 AGAAAGGAAGACAGCAGCCCTGG + Intergenic
1134109161 16:11503916-11503938 AGGAAGGAAGGAAGCAGGCCTGG - Intronic
1134180163 16:12041405-12041427 AGAAAAGAACACATCAGGCCAGG - Intronic
1134480754 16:14617087-14617109 AAAAAAGATCACAGTAGGCCAGG + Intronic
1134819344 16:17233565-17233587 AGAAAAGCTGTCTGCAGGCTGGG - Intronic
1135083860 16:19458937-19458959 AGCAAAGAAGCCAGCAGGCGGGG - Intronic
1135306909 16:21375155-21375177 AGAAAAGAACACATCAGGCCAGG - Intergenic
1135529418 16:23239853-23239875 AGAAAAGTTATCAGAAGGCCAGG - Intergenic
1135939587 16:26809728-26809750 AGAAAAGATGGCAAAATGCAAGG + Intergenic
1136243599 16:28959861-28959883 AGAAATGAATGCAGCAGGCCAGG - Intronic
1136303651 16:29354296-29354318 AGAAAAGAACACATCAGGCCAGG - Intergenic
1136400999 16:30018597-30018619 CGAAAAGATGGGAGCAGAGCAGG + Intronic
1136465389 16:30439579-30439601 ACAAAACAAGGAAGCAGGCCAGG - Intergenic
1136484372 16:30561761-30561783 AGAAAAGATGGCTGGCGGCTGGG + Intergenic
1136690948 16:32028629-32028651 AGAGAAGATGGCTGCAGGGAGGG - Intergenic
1138147151 16:54622908-54622930 AGATAAGACGGCAGAAGGCTGGG - Intergenic
1138209391 16:55150678-55150700 AGAACACAAGGCAGCAGGCAGGG + Intergenic
1139137750 16:64225217-64225239 AGAAAAGATGGCGCCAGCCAAGG + Intergenic
1139236601 16:65346061-65346083 AGAAAAGATGTATGCTGGCCAGG + Intergenic
1139374202 16:66486705-66486727 AGAAAAGAGGGGAGGAGGCTGGG + Intronic
1140010010 16:71122267-71122289 AGTATAGGTGGCAGGAGGCCTGG - Intronic
1140085247 16:71790243-71790265 AGAATAGACTGAAGCAGGCCAGG + Intronic
1140302150 16:73768318-73768340 AGAAAGGATGGGAGCAGACATGG + Intergenic
1140582250 16:76245239-76245261 AGAAAAGAAGGCAGAAAGGCAGG + Intergenic
1141133899 16:81453426-81453448 AGAGAAGCTAGCAGCAGTCCCGG - Intronic
1141828461 16:86496766-86496788 AAAAAAAAAGGCAGCCGGCCAGG + Intergenic
1141911289 16:87060109-87060131 AGAAAACATGGGAGCAGTCCAGG - Intergenic
1141957494 16:87382927-87382949 TGAAGAAATGGGAGCAGGCCGGG - Intronic
1142151214 16:88513278-88513300 AGATAAGATGGCAGCGAACCAGG - Intronic
1142180692 16:88668199-88668221 AGAAAAGATGGGGGGAGGGCAGG - Intergenic
1142180715 16:88668275-88668297 AGAAAAGATGGGGGGAGGGCAGG - Intergenic
1142180738 16:88668351-88668373 AGAAAAGATGGGGGGAGGGCAGG - Intergenic
1142300746 16:89256641-89256663 AGAAAACCTGGCATCAGTCCTGG + Intergenic
1142565078 17:835011-835033 AGAAAACGTCACAGCAGGCCTGG + Intronic
1142702322 17:1670780-1670802 AAAAATGATGAGAGCAGGCCAGG - Intronic
1142856525 17:2733586-2733608 TGAAAAGGTGGCATCAGGCAGGG + Intergenic
1142997227 17:3768013-3768035 TGAAAAGGTGTCAGCAGGGCTGG - Intronic
1143012806 17:3875576-3875598 AGGAAAGAGGTCAGGAGGCCGGG - Intronic
1143018290 17:3903509-3903531 AGAAATGCAGGCAGCTGGCCGGG - Intronic
1143674212 17:8419143-8419165 AGAAAATAAGGGATCAGGCCAGG - Intronic
1143736795 17:8916682-8916704 AGAAAAAGTGGAAGCAGGACTGG - Intronic
1144527361 17:16001102-16001124 AGAATAGATTGCAAGAGGCCAGG - Intronic
1144686414 17:17228965-17228987 AGAAAAGATGGCAGGGGGCCAGG + Intronic
1145240720 17:21239792-21239814 AAAAAAGATTGCAACAGGCCTGG + Exonic
1145725914 17:27124122-27124144 AGAAAAGAAGGCAGCCAGCTTGG + Intergenic
1146199859 17:30847623-30847645 AAAAAATATTGCAGTAGGCCAGG - Intronic
1146930210 17:36771677-36771699 GTGCAAGATGGCAGCAGGCCGGG + Intergenic
1147735454 17:42634789-42634811 AAAAATAATGGAAGCAGGCCAGG + Intergenic
1148593385 17:48833259-48833281 AGAAAAGTAAGCAGAAGGCCGGG + Intronic
1149569763 17:57664071-57664093 AGTAGAGGTGGAAGCAGGCCTGG - Intronic
1149836260 17:59915759-59915781 AAAAAAGATAGCAGTAGGCCAGG - Intronic
1150312888 17:64143914-64143936 AGAAAAGAAAAGAGCAGGCCGGG + Intergenic
1151276179 17:73036072-73036094 AGTCAAGGTGGCAGCAGGGCTGG - Intronic
1151878109 17:76878768-76878790 ATAAAAACTGGCAGCAGGCCAGG - Intronic
1152124880 17:78440552-78440574 AAAAAAGAGTGAAGCAGGCCGGG - Intronic
1152474958 17:80512076-80512098 AGGAACCAAGGCAGCAGGCCTGG + Intergenic
1153035030 18:753775-753797 AGTAAAGATGTCAGCCGGGCAGG - Intronic
1153414082 18:4825968-4825990 AGAAAAGATGCAACTAGGCCGGG + Intergenic
1154244563 18:12684408-12684430 AATAAAGGTGACAGCAGGCCAGG - Intronic
1154958999 18:21289029-21289051 AGAAAGCATGGTAGCTGGCCAGG - Intronic
1155197023 18:23485110-23485132 AAAAAAGAAGGCAGCAGGAAAGG + Intronic
1155217157 18:23653542-23653564 AGAAAAAATGGGACTAGGCCAGG - Intronic
1155860450 18:30891283-30891305 AGAAAAGATAGAAAGAGGCCAGG + Intergenic
1155939173 18:31786450-31786472 AGAACAGATAGCAGCTGGCTGGG - Intergenic
1156413405 18:36859495-36859517 AGAAAAGAAGGCAGGAAGGCAGG - Intronic
1156595430 18:38542852-38542874 AGAAAACATGTCAGCTTGCCAGG - Intergenic
1156967542 18:43113479-43113501 AGCAAAGATGAGAGCAAGCCAGG + Intronic
1156978486 18:43255947-43255969 AGGGAACATGGCAGCAGCCCAGG + Intergenic
1157134614 18:45041664-45041686 AGAAATAATGGATGCAGGCCAGG + Intronic
1157244306 18:46040057-46040079 AGACAACATGGCATCAGACCAGG + Intronic
1157488841 18:48108248-48108270 AGAAGAGAGGGCACCAGGCAAGG - Intronic
1157694012 18:49706371-49706393 TTAAAAGATTTCAGCAGGCCAGG + Intergenic
1157888334 18:51390119-51390141 AGAGAAGAAGGCAGGAGGCTGGG - Intergenic
1158239500 18:55361018-55361040 AGAAAAGGGGTTAGCAGGCCAGG - Intronic
1158467808 18:57707009-57707031 AGAAAATGAGGAAGCAGGCCGGG + Intronic
1158577929 18:58655968-58655990 AGAAAAGGTAAAAGCAGGCCGGG + Intergenic
1159470721 18:68852086-68852108 AGAAAAGAAGGCAGGCGACCTGG - Intronic
1159868927 18:73738842-73738864 AGAAAAGAGGGCAGGAAGGCAGG + Intergenic
1160096076 18:75874843-75874865 AGAAGTGATGTCAGGAGGCCAGG - Intergenic
1160118927 18:76109516-76109538 AGAAAACATAGCAGTGGGCCAGG - Intergenic
1162143794 19:8600791-8600813 AGAAAGGAAGGTTGCAGGCCGGG - Intronic
1162358843 19:10205307-10205329 AGAAAAGAAAGGAGAAGGCCTGG + Intronic
1162634185 19:11953721-11953743 TGGAAAGAGGGCAGCAGGTCAGG + Intronic
1162637551 19:11981914-11981936 TGGAAAGAGGGCAGCAGGTCAGG + Intergenic
1162724766 19:12683401-12683423 TCAAAAAATAGCAGCAGGCCAGG - Intergenic
1162971319 19:14182941-14182963 AGAGAAGAGGCCAGTAGGCCCGG - Intronic
1163569849 19:18074754-18074776 ACAAAAAATAGCAGTAGGCCGGG + Intronic
1163710382 19:18843116-18843138 AAAAGAGAGGGCAGGAGGCCAGG - Intronic
1163786763 19:19278835-19278857 AGGAAGGAGGGGAGCAGGCCTGG + Intronic
1164311011 19:24046289-24046311 AGTAAAGATGGTAGGTGGCCTGG + Intronic
1164667727 19:30052531-30052553 AGAATTGATTGCAGGAGGCCTGG + Intergenic
1165492006 19:36129132-36129154 AGGAAAGAATGCTGCAGGCCAGG + Intergenic
1166396237 19:42443420-42443442 ACATAAGATGGCAGCAGAGCAGG + Intergenic
1166747391 19:45147766-45147788 AGGAAAGGGGGGAGCAGGCCGGG + Intronic
1167004522 19:46766939-46766961 GGAGATGATGGCAGCTGGCCAGG + Intronic
1167061778 19:47153236-47153258 TGAAAACATGTCAGCAGACCAGG - Intronic
1168497705 19:56867861-56867883 AAAAAAGATGGCTATAGGCCAGG - Intergenic
1168661749 19:58172773-58172795 TCAAAACATGCCAGCAGGCCGGG - Intergenic
925598051 2:5576960-5576982 ACAAAAGATGACAAAAGGCCAGG + Intergenic
925794052 2:7524034-7524056 AGAATAAATGGGAGCAGACCAGG + Intergenic
925910583 2:8571130-8571152 AGAAATGATGGGAGCTGGACAGG + Intergenic
926806411 2:16715933-16715955 AGGAAAGAAAGCAGCAGGACTGG + Intergenic
927176451 2:20412157-20412179 ATAAAGGATGGAAGGAGGCCAGG - Intergenic
927767193 2:25821612-25821634 AGAAAATATGGGAACAGGCCAGG - Intronic
929161534 2:38837313-38837335 AGAAAAGATAGGACTAGGCCGGG + Intronic
929306950 2:40374214-40374236 AGAAAAGATGGAATAAGGCCAGG + Intronic
929635983 2:43521202-43521224 AGGAAAGAGGGCAGGAGGGCAGG + Intronic
929652800 2:43698542-43698564 AAAAAAGATGCAAGTAGGCCGGG - Intronic
930236226 2:48891244-48891266 AGAAAAGAAGGAAGCAGGAAGGG - Intergenic
930482281 2:51963895-51963917 GGAAAACATTGCAGCAGGTCAGG + Intergenic
931305769 2:61026639-61026661 AGAAAAGGTGGCCACAGGCCAGG - Intronic
931323716 2:61196977-61196999 AGTAAAGATGGAAATAGGCCAGG + Intronic
931535372 2:63270652-63270674 AGAAAAGTTGCCAGCCAGCCAGG + Intronic
931764963 2:65446851-65446873 AGAAAATATGGTACAAGGCCGGG - Intergenic
932416838 2:71578715-71578737 GGAAAAGGTGGCAGGAGGCAAGG - Intronic
932913395 2:75829272-75829294 AAAAAAGGTGTCAGCAGGCCGGG + Intergenic
933234703 2:79852031-79852053 AGAAAAGATGAGAGAAGGCCGGG - Intronic
934040871 2:88126542-88126564 TGGCAAGATAGCAGCAGGCCAGG - Intronic
934887623 2:98038815-98038837 AGAAAAGAAAGAAGGAGGCCGGG - Intergenic
934986646 2:98892393-98892415 AAAAAAGATCTGAGCAGGCCAGG + Intronic
935566637 2:104615649-104615671 AAAAAAAATAGCAGCTGGCCAGG - Intergenic
935725521 2:106020800-106020822 GGAAAATATTGCAGCAGCCCAGG + Intergenic
936796504 2:116212361-116212383 AGAAAAGTTGGAGGCAGCCCTGG - Intergenic
937232862 2:120409969-120409991 GGGAAATATGGCAGCAGGCTAGG - Intergenic
938397447 2:130961943-130961965 AGAAAGACTGGAAGCAGGCCGGG + Intronic
938982858 2:136543026-136543048 AACTAAGAAGGCAGCAGGCCTGG + Intergenic
940086950 2:149871021-149871043 AGAAAGGAAGGCAGCATGCCAGG - Intergenic
940961798 2:159794927-159794949 AGAAAAGGTGGCATCAGGCCGGG + Intronic
941064320 2:160883922-160883944 AGAAAATATAGGAGCAGGCCTGG + Intergenic
942061129 2:172229583-172229605 AGCACAGATGACAGCATGCCAGG - Intergenic
943120186 2:183725601-183725623 ATAAAAGAAGCAAGCAGGCCAGG + Intergenic
943706595 2:191041770-191041792 AGAAAAGAAGACTGCAGACCAGG + Intronic
946055379 2:216896398-216896420 AGAAAAGATGGAATGTGGCCAGG + Intergenic
946064141 2:216971940-216971962 AGCAAAGATGGAAGCAGAGCTGG + Intergenic
946425582 2:219594013-219594035 TGAAAAGAAGGGAGAAGGCCGGG - Intergenic
946626005 2:221613033-221613055 AGAGAGGAGGCCAGCAGGCCTGG + Intergenic
946951420 2:224879376-224879398 AGACAAGATGGCTGCAGAGCAGG + Intronic
947212304 2:227719166-227719188 AGAAAAGAGGCCAGGTGGCCGGG - Intergenic
947635704 2:231679938-231679960 AGAAAAGAGGGCTTTAGGCCGGG - Intergenic
947693532 2:232162368-232162390 AGCAGTGATGGCAGCAGGGCTGG - Intronic
947912150 2:233808550-233808572 AGAAAAGCTGGAAGAAAGCCTGG - Intronic
947989115 2:234473196-234473218 AACCAAGATGGCAGCAGGGCTGG + Intergenic
947989331 2:234474362-234474384 AACCAAGATGGCAGCAGGGCTGG - Intergenic
948160419 2:235818867-235818889 AGAAAAGATGGCCATGGGCCGGG - Intronic
948209564 2:236182620-236182642 AAAAAAGATAGCAGAGGGCCGGG - Intergenic
948663557 2:239521085-239521107 AGAAAAGAGGGCAGGCGGGCGGG - Intergenic
948781526 2:240324520-240324542 AGCTAAGAGGCCAGCAGGCCGGG - Intergenic
948783047 2:240336465-240336487 AGAAGAGATGGCAGGAAGCAAGG - Intergenic
1168923531 20:1560576-1560598 GGAGAAGATGGAAGCAGGACTGG + Intronic
1169194417 20:3675504-3675526 ACAAAGGAGGGCAGCAGGCAGGG - Intronic
1169463866 20:5820706-5820728 AGACAGTATGGCAGCAGGCTAGG - Intronic
1170009220 20:11703159-11703181 AGAAAACATGGCAATAGCCCAGG - Intergenic
1170037390 20:12003760-12003782 ACAAAACATGGCAGAAGGCAAGG - Intergenic
1170152233 20:13237726-13237748 AGTAAAGAATGCAGCAGGCAGGG + Intronic
1170256122 20:14345804-14345826 AGAAAGGAAGACAGCAGGCTGGG + Intronic
1170284406 20:14690707-14690729 ATAAAAACAGGCAGCAGGCCTGG - Intronic
1170309326 20:14975394-14975416 AGATCAGACGGCAGCAGGCTGGG + Intronic
1170348605 20:15415742-15415764 AGAAAAGATGGAAGGAGGAATGG - Intronic
1171507033 20:25645417-25645439 AGAAAATAAGGGAGGAGGCCAGG - Intergenic
1171972165 20:31571171-31571193 TGGAAAAATGGCACCAGGCCGGG + Exonic
1172192999 20:33073504-33073526 AGTAAAGATGGCTGCAGGGATGG + Intronic
1172474729 20:35227726-35227748 ATAAAACATAGCACCAGGCCTGG - Intronic
1172763867 20:37340564-37340586 AGAAAAGATGAAAGGAGGCTGGG - Intergenic
1172828266 20:37808846-37808868 AGAAAAGATGACAGCAGTGAAGG - Intronic
1173345073 20:42191824-42191846 AGAAAAGATGGAACCAGGTCTGG + Intronic
1173577886 20:44124749-44124771 ACAAAAGCTGGCAGCAGGCTGGG - Intronic
1174283288 20:49454627-49454649 AGATAAGAAGGCAGGAGGGCTGG + Intronic
1174842587 20:53914290-53914312 AGAAAACATAACACCAGGCCTGG - Intergenic
1174909950 20:54596798-54596820 AGTAAAGATGGCTTCAGGCTTGG + Intronic
1174956590 20:55104984-55105006 ATAAAAGATTGAAGCTGGCCAGG + Intergenic
1175329144 20:58150782-58150804 GCAAAGGATGGCAGCAAGCCCGG + Intergenic
1175355027 20:58358597-58358619 TAAAAAGAAGGCAGCAGGCCAGG + Intronic
1175847362 20:62065795-62065817 AAAAAAGATGGCGGCGGGCTCGG - Exonic
1175990373 20:62785566-62785588 AGGAGACCTGGCAGCAGGCCAGG - Intergenic
1176931699 21:14819906-14819928 AGAAAAACAAGCAGCAGGCCGGG - Intergenic
1177544126 21:22534629-22534651 AGAAAAAAAGGCTGAAGGCCAGG - Intergenic
1178584615 21:33861648-33861670 AGAAATGATGGCAGAAGGGCCGG + Intronic
1178847806 21:36187894-36187916 AGAAAAAAAAGAAGCAGGCCAGG - Intronic
1178886353 21:36488034-36488056 TCAAAAGGTGGCAGCAGGCCAGG + Intronic
1178969003 21:37154365-37154387 ATGTAAGATGGCAGCAAGCCTGG + Intronic
1179774565 21:43652838-43652860 AGAAAGAAGGGCATCAGGCCAGG + Intronic
1179826741 21:43970299-43970321 AGAAATGTTAACAGCAGGCCGGG - Intronic
1180051559 21:45333826-45333848 AGAAAAGACTGGAGGAGGCCAGG - Intergenic
1180197028 21:46203100-46203122 AGAAGAGAAGTCACCAGGCCAGG + Intronic
1180232102 21:46433084-46433106 AGAAGGGATGAGAGCAGGCCGGG + Intronic
1180592592 22:16953929-16953951 AGCAATTATGGCAGGAGGCCTGG + Intergenic
1180799645 22:18625829-18625851 AGAAAGGAGGGGAGCAGCCCTGG - Intergenic
1181222071 22:21369437-21369459 AGAAAGGAGGGGAGCAGCCCTGG + Intergenic
1181266353 22:21633140-21633162 AGAGAGGTGGGCAGCAGGCCCGG + Exonic
1182107567 22:27700206-27700228 ACAAAAGATGTCATTAGGCCAGG + Intergenic
1182452211 22:30428390-30428412 GGAACAGAAGGCAGAAGGCCAGG - Intronic
1182686747 22:32126657-32126679 AGAGAAGAGGGAAGTAGGCCAGG + Intergenic
1182836549 22:33346596-33346618 AGAAAAGAAGGTAGGAGGCCAGG - Intronic
1183890871 22:40927499-40927521 AGAAAAGATGGCAGGATGTCAGG - Exonic
1183943367 22:41309303-41309325 AGAAAAAAAGAAAGCAGGCCGGG - Intronic
1184216790 22:43072893-43072915 ATTAAAGATGGCCACAGGCCAGG - Intronic
1184282399 22:43445512-43445534 AGATAAGATGGCAGCAAGAGGGG - Intronic
1184354637 22:43970874-43970896 AGAAAAGATGGTGCCAGGCGGGG + Intronic
1184470699 22:44694240-44694262 AGAAAAGGTGACTGCTGGCCAGG + Intronic
1184506232 22:44905216-44905238 AGAAAAAATAGGAGCAGGCAGGG - Intronic
1184702722 22:46187491-46187513 AGAAAAGATGGTGACAGCCCTGG - Intronic
1184725495 22:46342660-46342682 AGAAAAGGTTGCAGTGGGCCAGG + Intronic
949130675 3:496659-496681 AGAAATGATGACATCAGACCTGG + Intergenic
949225754 3:1693188-1693210 AGACAAGATGGCAACAGCCAAGG + Intergenic
949550841 3:5111624-5111646 AGAAAAGCTGGTAGAAGGCCGGG + Intergenic
949980493 3:9499487-9499509 TGCCAAGATGGCAGCTGGCCAGG + Exonic
950230472 3:11271514-11271536 AGAAAGGATTACTGCAGGCCCGG - Intergenic
950314381 3:11987670-11987692 TCAAAACATGGCAGCTGGCCTGG + Intergenic
950545299 3:13634642-13634664 AGAAAACACGGCAAGAGGCCAGG - Intronic
950643541 3:14363693-14363715 AGCAAAGATCACAGCAGCCCTGG + Intergenic
950671877 3:14532207-14532229 AGAAAAGACGGGAGAAGGTCTGG + Intronic
951729161 3:25791572-25791594 GGTCAATATGGCAGCAGGCCAGG + Exonic
952133675 3:30393304-30393326 TGGAGAGAGGGCAGCAGGCCAGG + Intergenic
953409753 3:42684096-42684118 AGGAGAGATGACAGCAGGCTGGG - Intergenic
953605980 3:44413581-44413603 AGAAAGGATGGCTTGAGGCCAGG - Intergenic
953814504 3:46143536-46143558 AGAAAAAATGGAGCCAGGCCTGG - Intergenic
954380281 3:50215590-50215612 AGGAAAGCTGGCAGCAGCCCTGG + Exonic
954395490 3:50291303-50291325 AGATAAAATGGGAGCAGGCTGGG - Intronic
954612373 3:51952521-51952543 AGAAAAGATGGTCGCAAGCTGGG + Intergenic
955069788 3:55562446-55562468 AAAAAAGAAGGCAGCGGGCCAGG - Intronic
955491486 3:59487651-59487673 AGGAAAGATGGCACAAGGTCAGG - Intergenic
955866019 3:63385265-63385287 AGAAAGGAAGGAAGCAGGGCGGG - Intronic
956596290 3:70971117-70971139 AGAAAGGAAGGCAGCAGCCTAGG + Intronic
956895853 3:73658919-73658941 AAACAAAATGTCAGCAGGCCTGG + Intergenic
956912435 3:73832529-73832551 AGAAAAGAAGGCTGCTTGCCAGG + Intergenic
959932479 3:111999290-111999312 AGCAAAGAGGGCAGAAAGCCGGG - Exonic
960046988 3:113208697-113208719 AGAAAGGTGAGCAGCAGGCCGGG + Intergenic
961262202 3:125611165-125611187 AGAAATTATGGCAGGTGGCCAGG - Intergenic
961387579 3:126531038-126531060 GGAATAGATGGCAGCTGGACGGG - Intronic
961989053 3:131168081-131168103 ACAAAAGAGGGCAGGATGCCTGG - Intronic
962003773 3:131327657-131327679 AGAAACGTTAGCAGCAGGCCTGG + Intronic
962271820 3:133982963-133982985 AGAAAATATGGAGGCAGGCTGGG - Intronic
963174679 3:142285277-142285299 AGACAAGATGGCACCGGCCCAGG + Intergenic
963746290 3:149127984-149128006 AGATAAGATGTCAGCAGGTATGG - Intergenic
963794354 3:149616735-149616757 AAAAGAGAGGACAGCAGGCCAGG - Intronic
963943520 3:151119368-151119390 AGATAAGGTGTCAGCAGGTCTGG + Intronic
964638045 3:158878790-158878812 AAAAAAGATGGAACCTGGCCAGG - Intergenic
966157157 3:176929310-176929332 AGGAAAGATGGCAGCTGGTAAGG - Intergenic
966789626 3:183655329-183655351 AGAAACAATGGCTGTAGGCCAGG + Intronic
966866295 3:184260717-184260739 ACAAGAGAGGGCAGGAGGCCGGG - Intronic
966949253 3:184801315-184801337 AAAAAAGCTGGCTGCAGGGCAGG - Intergenic
967024742 3:185554886-185554908 AGAAAAGAAAGCGGCGGGCCGGG - Intergenic
967313324 3:188127147-188127169 TGAAAAGATAGCAGCCTGCCAGG - Intergenic
967830252 3:193912568-193912590 ATAAAAGGTGGCTGCAGGCCTGG - Intergenic
967992017 3:195138560-195138582 AGAAAAGTGGGCTGGAGGCCAGG + Intronic
968326837 3:197824863-197824885 AGAAAGCTGGGCAGCAGGCCAGG - Intronic
968435815 4:588444-588466 TGAAAAGATGGCCGCACGCGTGG - Intergenic
968435831 4:588527-588549 TGAAAAGATGGCCGCACGCGTGG - Intergenic
968435862 4:588692-588714 TGAAAAGATGGCCGCACGCATGG - Intergenic
968435876 4:588775-588797 ACAAAAGATGGCCGCACGCATGG - Intergenic
968763784 4:2457719-2457741 GGAAAAGAGGGCCACAGGCCGGG - Intronic
968914756 4:3492530-3492552 AGAACAGGTGGCAGAAGGACAGG + Intronic
969273780 4:6120903-6120925 TCAAAAAATGGCAGCAGGCCGGG + Intronic
969381426 4:6801391-6801413 TGAAAAGATGCCACTAGGCCAGG + Intronic
969569115 4:7998179-7998201 AAAAAAGACAGCAGAAGGCCCGG - Intronic
970313665 4:14809003-14809025 GGAAAAGAAGGAAGCAGGACTGG - Intergenic
970669924 4:18384576-18384598 AGTCAAGATGTCAGCAAGCCTGG - Intergenic
970982334 4:22114508-22114530 AGAAAAGATGAAACTAGGCCAGG + Intergenic
971298710 4:25424495-25424517 AGAAAAGAAGAAAGAAGGCCAGG - Intergenic
971407461 4:26335473-26335495 AGAAATAATGGATGCAGGCCGGG - Intronic
971455848 4:26842802-26842824 AGAAAACATGGAAATAGGCCAGG - Intergenic
972121561 4:35710391-35710413 ATAAAACAAAGCAGCAGGCCTGG - Intergenic
972314880 4:37917064-37917086 ACAAAACATAGCAGCAGGCCAGG - Intronic
972808657 4:42558877-42558899 AAAAACTATGGCAACAGGCCGGG + Intronic
973791871 4:54385342-54385364 AAAGAGGATGGCAGGAGGCCAGG + Intergenic
974006854 4:56566490-56566512 TTAAAAGAAGGCAACAGGCCAGG - Intronic
974038184 4:56835455-56835477 AGAAAAGATATCTCCAGGCCAGG + Intergenic
976317372 4:83673071-83673093 AGAAAAGATGGTACAAGGTCTGG - Intergenic
976651587 4:87440550-87440572 ATAAAATATGGTTGCAGGCCGGG + Intronic
977500295 4:97828850-97828872 AGAAAAAAAGGCAGCTGCCCTGG + Intronic
977698170 4:99990578-99990600 AGAAAAGACAGTAGCTGGCCGGG - Intergenic
977802325 4:101250512-101250534 AGACAAGAAGGCAGGAAGCCTGG - Intronic
979276831 4:118823741-118823763 GGAAAAGTTGGAAGCAGGCCTGG - Intronic
980757794 4:137189002-137189024 AGACAAGATGTCAGCAGGATTGG + Intergenic
981558818 4:146024731-146024753 AGAGAAAATGGCAGCAGGCCAGG - Intergenic
981884207 4:149653221-149653243 GGAGAAGATGGCAGCAGGTGTGG + Intergenic
982235851 4:153250413-153250435 AGAAAAGACTGAAGTAGGCCTGG - Intronic
982340402 4:154292510-154292532 AGAATAGATACCAGCAGCCCAGG - Intronic
984250060 4:177320760-177320782 ATTAAAAATGACAGCAGGCCCGG - Intronic
984430925 4:179648279-179648301 ATAAAAGAAGTCAGCAGGCCAGG + Intergenic
984534978 4:180963234-180963256 AAAAAAAATGGCAGCAGGTTGGG - Intergenic
984694199 4:182763270-182763292 AGAAAAGATGGGGGCGGGCGCGG + Intronic
985137419 4:186801188-186801210 ATAAAAAATGGAAGCAGGCCAGG - Intergenic
985516998 5:352093-352115 AGAAAAGATGGCAGCCAGTATGG - Intronic
985963448 5:3321240-3321262 AGAATAGATGACAGCTGGCTGGG - Intergenic
986333215 5:6733315-6733337 AGAAAGGCTGGCGGCACGCCGGG - Intronic
987008369 5:13734598-13734620 AGAAGGGATGGCATCAGGTCAGG - Intronic
987438196 5:17923917-17923939 AGAAAACATGGAAGGGGGCCGGG + Intergenic
988477620 5:31601360-31601382 AGAAAAGCTGAGAGCTGGCCGGG + Intergenic
988707408 5:33739814-33739836 TGTAAAGAAGGCAGAAGGCCTGG + Intronic
989201149 5:38764902-38764924 AGAAAAGACTACAGTAGGCCGGG - Intergenic
989602844 5:43215722-43215744 GGAAAAGATGGGACCAGGCATGG - Intronic
990584547 5:57197652-57197674 AAAAAAAATTGAAGCAGGCCAGG - Intronic
991560728 5:67948742-67948764 AAAAATGAAGGAAGCAGGCCAGG - Intergenic
991659405 5:68935044-68935066 AGAAAGGGTCTCAGCAGGCCTGG + Intergenic
992754253 5:79889273-79889295 AGAAGAGATAGAAGCAGGCTGGG + Intergenic
992777491 5:80101417-80101439 AGAAAACATGAAAGAAGGCCTGG + Intergenic
992949337 5:81841907-81841929 AGAAAAGGTGGAGGCAGCCCAGG - Intergenic
994476112 5:100272445-100272467 AGAAAAGTTAGAAGCTGGCCGGG + Intergenic
996180223 5:120409898-120409920 AGAAAAGAACACACCAGGCCGGG + Intergenic
996641895 5:125764882-125764904 AGACAAAATTGCAGCAGGACAGG - Intergenic
997754851 5:136386681-136386703 AGGAGTGAGGGCAGCAGGCCTGG - Intronic
997971694 5:138408108-138408130 AGACAAGATGGCACCAGCCAAGG + Intronic
998002052 5:138633121-138633143 AAAAAGGATGTGAGCAGGCCGGG - Intronic
998002204 5:138634251-138634273 AGGAAAGAGGGGAGGAGGCCGGG + Intronic
998800689 5:145865840-145865862 AGAAAAGATAGGGCCAGGCCAGG + Intronic
998832136 5:146171059-146171081 ATAAAAGGTTGCAGAAGGCCGGG + Intronic
998861028 5:146444529-146444551 ATAAAAGATGAAAACAGGCCGGG - Intergenic
999148669 5:149412472-149412494 AGAAAAGAAAGCTCCAGGCCGGG + Intergenic
999292706 5:150437216-150437238 AGAAAAGAAGGAAGAAGGCAGGG + Intergenic
1000013996 5:157261610-157261632 ACAAGAGATGGCCACAGGCCAGG + Intergenic
1000076116 5:157788670-157788692 AGAAAAGATGGAAAGTGGCCAGG + Intronic
1000388587 5:160699804-160699826 AGATAAGATGGTAGCAGGTTTGG + Intronic
1001076012 5:168628688-168628710 AGAAAAGAGGGAAGGAGGGCAGG - Intergenic
1001101883 5:168821054-168821076 AGAGAAAATGGCAGCAGGCAGGG + Intronic
1001284449 5:170412302-170412324 AGAAAAGATGGGAGAAGCCTTGG + Intronic
1001507611 5:172292356-172292378 ACAAAAGAAGGAAACAGGCCAGG - Intergenic
1001684345 5:173582276-173582298 AGAAAGGAAGGGAGAAGGCCTGG + Intergenic
1001742869 5:174068247-174068269 AGAAAAGAAGGGAGCAGGGTGGG + Intronic
1001806895 5:174594460-174594482 AGAAGAGATGGATGAAGGCCTGG + Intergenic
1001810691 5:174625769-174625791 AGGGAAGATGGCATGAGGCCAGG + Intergenic
1001892229 5:175349272-175349294 TGGAAAAGTGGCAGCAGGCCAGG - Intergenic
1001946256 5:175780758-175780780 AGAAAGGATGGATGCAGGGCTGG - Intergenic
1002176748 5:177404989-177405011 AGACAGGCTGGCAGGAGGCCGGG - Intronic
1002266911 5:178041301-178041323 AAAAAACATAGCAGCAGGACAGG + Intronic
1002390893 5:178910747-178910769 GGAAACGATGGCAGCATGGCGGG + Intronic
1002480705 5:179498853-179498875 TGAAAGCATGGCAGCAGGGCAGG + Intergenic
1002516191 5:179760794-179760816 TTTAAAGATGGAAGCAGGCCGGG + Intronic
1002516242 5:179761096-179761118 AAAAAAGATGGAAGGAGGCCAGG + Intronic
1003373500 6:5551696-5551718 AGTAAAGGTGTCAGCAGGGCTGG + Intronic
1004322773 6:14645669-14645691 CAAAATGATGGCAGGAGGCCAGG - Intergenic
1004380823 6:15130968-15130990 AGAAACAATGGCTGGAGGCCGGG + Intergenic
1005085434 6:22001525-22001547 AGAAAAGAAAGCACCAGTCCTGG - Intergenic
1005524040 6:26628016-26628038 CTAAAAACTGGCAGCAGGCCAGG + Intergenic
1006337708 6:33429046-33429068 AGAGCAGAGAGCAGCAGGCCAGG + Intronic
1006744866 6:36334442-36334464 AGAAAAGAAGGAAGTAGGGCTGG - Intronic
1006756152 6:36417457-36417479 CCAAGAGATAGCAGCAGGCCAGG + Intronic
1006912977 6:37576068-37576090 AGAAAAGCGGGGAGCAGGGCTGG + Intergenic
1007543085 6:42668052-42668074 AGAAAAGTTGTTAGGAGGCCAGG - Intronic
1007683519 6:43650609-43650631 AGAAATTATGGCAACAGGCTGGG + Intronic
1008129594 6:47705484-47705506 AGAGAACATGGCAGCATGACAGG - Intronic
1008267623 6:49449935-49449957 AGAAAAGATAAGAGCAGGCAGGG + Intronic
1008538974 6:52529825-52529847 AGAAAGGAAGCCAGCAGGCCTGG + Intronic
1008652174 6:53574664-53574686 ATAAAAGATGTCATCAAGCCGGG - Intronic
1008862192 6:56162258-56162280 AGAAAATCTGGCAGGAGGACAGG - Intronic
1008869834 6:56260286-56260308 AGAAAACATGGAATCTGGCCAGG + Intronic
1010040197 6:71372808-71372830 TAAAATGATGACAGCAGGCCGGG + Intergenic
1010274105 6:73949050-73949072 AGAAAAGAAGGCAGCAGGAAGGG + Intergenic
1010574462 6:77513834-77513856 AGACAAGATGGCACCAGCCAAGG - Intergenic
1011132773 6:84068962-84068984 ATAAAAGAATTCAGCAGGCCGGG - Intronic
1011201602 6:84842923-84842945 AGAAAATATGGCTGCAGTCCAGG + Intergenic
1011250057 6:85361829-85361851 AGTAAAGCTGGCAGCTGCCCAGG + Intergenic
1012911376 6:105121561-105121583 ACAAAAGATGAAAGTAGGCCAGG - Intronic
1012929113 6:105298426-105298448 AGAACTGATGGCTGCTGGCCCGG + Intronic
1012942765 6:105433370-105433392 AGAAAAGATGGCACTTGGACAGG - Intergenic
1013210721 6:107984289-107984311 AGAACAGATGTCATCAGCCCAGG + Intergenic
1013232672 6:108171165-108171187 ATAAAAGATGACAGCAGGCCCGG - Intronic
1013353478 6:109327014-109327036 AGAAAAGACAGCAGCTGGCCAGG - Intergenic
1013395882 6:109739151-109739173 GGAAAAGATTGCAGTAGTCCAGG + Intronic
1013559634 6:111291457-111291479 AGCAGAGATGGCAGCAGTCAAGG - Intergenic
1013644278 6:112120746-112120768 TGAAAATATGGCTGCAGGCTGGG + Intronic
1013812653 6:114062258-114062280 TGGAAAGATGGCTGCAGGCGTGG - Intronic
1014616578 6:123608875-123608897 AAAAAAAATGGAAGCAGGCTGGG + Intronic
1015549427 6:134396725-134396747 AGAAAAGGTGACAAGAGGCCAGG - Intergenic
1015623504 6:135156782-135156804 AGAAAAGAGGGTAGCTGGCAAGG - Intergenic
1016921640 6:149300756-149300778 GGAAGAGTTGGCAGAAGGCCAGG + Intronic
1017145920 6:151234689-151234711 AGAAAAGACAGGAGAAGGCCAGG - Intergenic
1019036603 6:169065248-169065270 AGAAAGGGTGGGAGCAGGCGGGG - Intergenic
1019267315 7:125125-125147 ACAAATGATCGCATCAGGCCTGG - Intergenic
1019270479 7:144347-144369 AGCAACGCAGGCAGCAGGCCAGG - Intergenic
1019340999 7:508910-508932 AAACAAGATGGCAGCAGCCTCGG + Intronic
1019642036 7:2108748-2108770 AGAAACAAAGGCAGCAGCCCTGG + Intronic
1019839145 7:3421833-3421855 AGGAAGGAAGGCAGCAGCCCTGG - Intronic
1019931053 7:4223416-4223438 AGTCAAGGTGGCAGCAGGGCAGG + Intronic
1020095070 7:5363628-5363650 AGGAGAGAAGGCAGCACGCCTGG + Intronic
1020287825 7:6699169-6699191 AGAAAATATGGTAGCAGGAATGG + Intronic
1021689189 7:23215545-23215567 AACAAAGCTGGCAGTAGGCCGGG - Intergenic
1022335327 7:29416557-29416579 AGAAACGATGGGAGAGGGCCTGG - Intronic
1023369858 7:39502399-39502421 AGAAAAGGTGGCAGGAGAGCAGG - Intergenic
1023420165 7:39970754-39970776 AAAACAGATGACAACAGGCCAGG - Intronic
1023992130 7:45134592-45134614 AGAAGGGAGGGCAGCAGGCCTGG + Intergenic
1024511902 7:50211436-50211458 AGAGAAGCTGTCTGCAGGCCAGG + Intergenic
1025900602 7:65741449-65741471 AGAAAAAATGACAGCTGGCCAGG + Intergenic
1026418595 7:70209393-70209415 AGAAAAGATGTCATCTGGGCAGG + Intronic
1026578716 7:71596331-71596353 AAAAAACAAAGCAGCAGGCCAGG - Intronic
1026760410 7:73122089-73122111 AGGAAGCATGGCAGAAGGCCAGG - Intergenic
1026853619 7:73739213-73739235 AGAAACGATGGCAGCCACCCAGG - Intergenic
1027036752 7:74930910-74930932 AGGAAGCATGGCAGAAGGCCAGG - Intergenic
1027086811 7:75270549-75270571 AGGAAGCATGGCAGAAGGCCAGG + Intergenic
1027159556 7:75792322-75792344 AGAAAAGAAGCCACCAGGCATGG + Intergenic
1027235028 7:76293069-76293091 AGAGAGGAAGGCAGGAGGCCCGG - Intergenic
1028253169 7:88559304-88559326 ATAAAAGATAGCAGCAGTCTTGG - Intergenic
1028586858 7:92460631-92460653 ATAAAAGATGGAAGGAGCCCAGG + Intergenic
1028808748 7:95060005-95060027 AGACAACTTGGCAGCAGTCCTGG + Intronic
1028875034 7:95812324-95812346 AGCCAAGATGGCTCCAGGCCAGG - Intronic
1029105333 7:98170561-98170583 AGAAAAGACGGCTGGAGGCGGGG - Intronic
1029126674 7:98299451-98299473 TCAAAAGATGGCAGCCTGCCGGG - Intronic
1029161952 7:98558878-98558900 AGAAAAGATGGCTTTGGGCCGGG - Intergenic
1029393113 7:100288547-100288569 AGGAAGCATGGCAGAAGGCCAGG + Intergenic
1029410505 7:100406829-100406851 AGAAAAGCAGGGAGCAGGACAGG - Intronic
1029628454 7:101735031-101735053 AGAAGAGGTGGCACAAGGCCTGG - Intergenic
1030302949 7:107992599-107992621 AGAACAGAAGGGAACAGGCCAGG + Intronic
1030729264 7:112965736-112965758 AGAAAAGTTGCCAACATGCCAGG + Intergenic
1031083477 7:117280138-117280160 AGGAAGGATGGCAAAAGGCCGGG + Intronic
1031138188 7:117909257-117909279 ATAAAAACAGGCAGCAGGCCAGG + Intergenic
1032314482 7:130822058-130822080 AGAAACAATGGAAGCAGGCTGGG - Intergenic
1032656577 7:133936954-133936976 AGAAAAGATGACTGAAGGCCGGG - Intronic
1033115103 7:138618363-138618385 AGAAAGGAGGGTAGCAGGCTGGG + Intronic
1033285411 7:140037025-140037047 AGAAAAGATGGCAGCAGGCCAGG + Intronic
1033343928 7:140512748-140512770 ACAGATGCTGGCAGCAGGCCAGG - Intergenic
1033493830 7:141873083-141873105 GGAAAAGATGACATCAGGCATGG - Intergenic
1033524175 7:142194005-142194027 AGAAAAGACTGCAGGAGGACAGG - Intronic
1034244737 7:149635850-149635872 AGCAGAGGGGGCAGCAGGCCTGG - Intergenic
1034763095 7:153692275-153692297 GGTAAAGAAGGAAGCAGGCCTGG + Intergenic
1035393849 7:158523100-158523122 AGATAAGAGCGCAGGAGGCCAGG + Intronic
1035893883 8:3375375-3375397 AGAAAAGATGGAAACAGATCAGG - Intronic
1036773133 8:11592505-11592527 AGAAAAGTTGGAGGCAGGGCAGG - Intergenic
1037493670 8:19419139-19419161 AGGAAAAGTGGCTGCAGGCCGGG - Intronic
1037910522 8:22741206-22741228 AGCAGAGATGGCAGCTGGCTTGG - Intronic
1038448568 8:27622641-27622663 AAAAAACATGGCATTAGGCCTGG + Intergenic
1038685518 8:29713949-29713971 ATTAAAAATGACAGCAGGCCAGG - Intergenic
1038946101 8:32361867-32361889 AGAAGAGCTGGAAGCAGGCATGG - Intronic
1039089525 8:33813469-33813491 AAAAAAGGTAGCAGCAGGTCTGG - Intergenic
1039373353 8:37009353-37009375 AGGAATGATGGCAGGAGGCGGGG + Intergenic
1039399363 8:37255949-37255971 AGAAGAGATGGCAGTAAGCATGG - Intergenic
1039574531 8:38612732-38612754 TGAAAAGAAGGCAGAAGGCCTGG + Intergenic
1039597556 8:38804594-38804616 ATAAAAAATTGCAACAGGCCGGG - Intronic
1039952105 8:42180585-42180607 GGCAAAGATGGCAGCCTGCCAGG + Exonic
1040019240 8:42725383-42725405 AGAAAAGACAGTAGCTGGCCGGG - Intronic
1040277061 8:46019166-46019188 AGAAAAGAGGACAGCAAGTCAGG - Intergenic
1041691573 8:60693138-60693160 AACAAAGATGCCAACAGGCCAGG - Intronic
1042221439 8:66478380-66478402 AGAAATGGAAGCAGCAGGCCGGG - Intronic
1043159876 8:76833076-76833098 AGAAAATATGGGAGCAGGAAAGG - Intronic
1044301636 8:90591202-90591224 AGACAACATGGCTGCAGGTCAGG + Intergenic
1044681714 8:94785672-94785694 AGAACAGATTGAAGCAGGCAGGG + Intronic
1044982046 8:97726777-97726799 TTAAGAGATGGCAGCTGGCCGGG + Exonic
1045389704 8:101703391-101703413 AGGACAGGTGGCAGCAGGACAGG + Intronic
1045841810 8:106589960-106589982 AGAAAAGACAGTAGCTGGCCGGG - Intronic
1046091038 8:109503008-109503030 AGAGAAGACAGCAGCTGGCCAGG + Intronic
1046544748 8:115635712-115635734 AGAAGAAATGGCAGGAGACCTGG + Intronic
1046911375 8:119631188-119631210 AAAAAAGATAGCAGCATGGCTGG - Intronic
1047366244 8:124214357-124214379 TGAAAAGATGTGAGAAGGCCAGG + Intergenic
1049760071 8:144328070-144328092 AGAAAAAATAACAACAGGCCAGG - Intergenic
1050561950 9:6843222-6843244 AAACAGCATGGCAGCAGGCCGGG - Intronic
1050852088 9:10300742-10300764 TGAAAAAAAGGCAGCAGCCCAGG + Intronic
1053082326 9:35186792-35186814 AGACAAGATGGCACCAGACAAGG - Intronic
1053083261 9:35195106-35195128 AGACAAGATGGCATCAGCCAAGG - Intronic
1053214507 9:36259143-36259165 AGAAAAGATGGCTTGAGGCCAGG - Intronic
1054746828 9:68862496-68862518 AGAAAAGCTGGAAGTGGGCCGGG + Intronic
1055926203 9:81512342-81512364 TAAAAAGAGGGCAGGAGGCCAGG + Intergenic
1056503116 9:87230346-87230368 AGAGAAGATGGCAGGAGGCAAGG - Intergenic
1056896468 9:90555272-90555294 AGAGAGCATGGCAGGAGGCCAGG + Intergenic
1057049508 9:91912831-91912853 ACAAAATAGGCCAGCAGGCCAGG + Intronic
1057188142 9:93070462-93070484 AGAAAGGATGGGGGCAGCCCGGG + Intronic
1057835176 9:98438705-98438727 ATAAAAAATGGTGGCAGGCCAGG - Intronic
1058149521 9:101449105-101449127 AGAAAAGAAGGCAGGTGGGCGGG + Intergenic
1059217961 9:112584173-112584195 AGAAAAGAAGGGGGCAGGGCTGG - Intronic
1059735822 9:117098809-117098831 AGAAAAGAAGGGAGAAGGGCTGG + Intronic
1059882119 9:118702771-118702793 AGAAAAGATGGAAACAGGCCAGG - Intergenic
1060563173 9:124565131-124565153 AAAAAAGAAGTCAGAAGGCCAGG + Intronic
1060905192 9:127298472-127298494 AGAAAACCTGGAAGCAGGCCGGG - Intronic
1060937075 9:127522048-127522070 TGGAGAGATGGCACCAGGCCAGG + Intronic
1060977354 9:127772553-127772575 AGAAAAAAAGTCAGCTGGCCGGG - Intronic
1061684467 9:132263792-132263814 AAAAAAGATGGGAGGAGGGCGGG - Exonic
1061856149 9:133442981-133443003 AGACAAGGTGGCAGCAGGTGTGG - Intronic
1062460632 9:136661256-136661278 GAACAAGTTGGCAGCAGGCCGGG - Intronic
1203733482 Un_GL000216v2:113344-113366 ATAAAAGATGTCCACAGGCCGGG + Intergenic
1186674765 X:11804629-11804651 AGAAGAGTTGGCAGCAGACATGG - Intergenic
1187012761 X:15296996-15297018 AGAAAACATGGTACAAGGCCGGG + Intronic
1188291410 X:28393159-28393181 AGAAAAGTTGGAAGCAGGCCAGG - Intergenic
1188839959 X:35004346-35004368 AGTGAAGATGTCAGCAGGACTGG - Intergenic
1190394141 X:49962776-49962798 AGAAAAGATGGGACCGGGCCAGG - Intronic
1190888157 X:54547289-54547311 AGAAAAGGTGGCTTCTGGCCGGG - Intronic
1192083748 X:68073539-68073561 ATAAAAGATGGCATTAGTCCTGG + Intronic
1192118084 X:68430525-68430547 AGAAAAGAAGGAAAGAGGCCAGG + Intronic
1192176433 X:68888879-68888901 AGAAATGATGGCGGCAGTGCAGG + Intergenic
1192214089 X:69146013-69146035 AGAAGACAGGGCAGCAGCCCTGG - Intergenic
1192321636 X:70094896-70094918 TGAAAATATGGGAGCTGGCCCGG - Intergenic
1193139427 X:78010872-78010894 ATAAAAGCTAGCACCAGGCCGGG - Intronic
1193842640 X:86426619-86426641 AGAAAAGCTGGAGGCAGACCAGG - Intronic
1194432857 X:93832357-93832379 AGAGAAGATGGCATGAGTCCAGG - Intergenic
1194482439 X:94442600-94442622 AGACAAGATGGCACCAGCCAAGG - Intergenic
1194588928 X:95772615-95772637 AGATAAGAAGACAACAGGCCGGG - Intergenic
1195035388 X:100967302-100967324 AGAAAACAGGCCAGGAGGCCGGG + Intergenic
1195037961 X:100987355-100987377 AGAAGAGAAGGCTGCAGACCTGG - Intronic
1195376666 X:104234513-104234535 ATAAAAGTTAGCAGGAGGCCAGG - Intergenic
1195522896 X:105851106-105851128 AGCAGAGGTAGCAGCAGGCCTGG + Intronic
1198251113 X:134880095-134880117 TGAAAAGATGTCAAGAGGCCAGG - Intergenic
1198295530 X:135283113-135283135 AGAAGAGAGGGAAGGAGGCCAGG - Intronic
1198458755 X:136843223-136843245 AGAAAGGAATGCAGCCGGCCAGG + Intergenic
1198485752 X:137085912-137085934 AGAATTGGTGGCAGCAGGCCTGG + Intergenic
1198860144 X:141060420-141060442 AGAAATGATGGAAGCTGGCTGGG - Intergenic
1198902549 X:141526970-141526992 AGAAATGATGGAAGCTGGCTGGG + Intergenic
1199000945 X:142635697-142635719 AAAAAAAAAGGCAGAAGGCCAGG + Intergenic
1199116086 X:143994631-143994653 AAAAAGGGTGGCAGGAGGCCTGG + Intergenic
1199771805 X:150979954-150979976 AGAAAAGGTGACAGAAAGCCAGG - Intergenic
1200306641 X:155032264-155032286 AAAAAAGAAGGCACCAGGCGTGG - Intronic
1202627528 Y:56875073-56875095 ATAAAAGATGTCCACAGGCCGGG - Intergenic