ID: 1033285412

View in Genome Browser
Species Human (GRCh38)
Location 7:140037030-140037052
Sequence AGATGGCAGCAGGCCAGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1179
Summary {0: 1, 1: 0, 2: 11, 3: 115, 4: 1052}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033285403_1033285412 18 Left 1033285403 7:140036989-140037011 CCATCCGTTAAACCCATCAACTC 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1033285412 7:140037030-140037052 AGATGGCAGCAGGCCAGGCGCGG 0: 1
1: 0
2: 11
3: 115
4: 1052
1033285402_1033285412 22 Left 1033285402 7:140036985-140037007 CCTACCATCCGTTAAACCCATCA 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1033285412 7:140037030-140037052 AGATGGCAGCAGGCCAGGCGCGG 0: 1
1: 0
2: 11
3: 115
4: 1052
1033285406_1033285412 5 Left 1033285406 7:140037002-140037024 CCATCAACTCCAAAGTCGCCTAC 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1033285412 7:140037030-140037052 AGATGGCAGCAGGCCAGGCGCGG 0: 1
1: 0
2: 11
3: 115
4: 1052
1033285405_1033285412 6 Left 1033285405 7:140037001-140037023 CCCATCAACTCCAAAGTCGCCTA 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1033285412 7:140037030-140037052 AGATGGCAGCAGGCCAGGCGCGG 0: 1
1: 0
2: 11
3: 115
4: 1052
1033285407_1033285412 -4 Left 1033285407 7:140037011-140037033 CCAAAGTCGCCTACAGAAAAGAT 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1033285412 7:140037030-140037052 AGATGGCAGCAGGCCAGGCGCGG 0: 1
1: 0
2: 11
3: 115
4: 1052
1033285404_1033285412 14 Left 1033285404 7:140036993-140037015 CCGTTAAACCCATCAACTCCAAA 0: 1
1: 0
2: 0
3: 22
4: 357
Right 1033285412 7:140037030-140037052 AGATGGCAGCAGGCCAGGCGCGG 0: 1
1: 0
2: 11
3: 115
4: 1052

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033285412 Original CRISPR AGATGGCAGCAGGCCAGGCG CGG Intronic
900103472 1:972473-972495 AGGGGGCAGCAGACCGGGCGTGG + Intronic
900279860 1:1859716-1859738 AGAGGGAGGCAGGCCGGGCGCGG + Intronic
900340681 1:2187592-2187614 AAATGGCTTCAGGCCGGGCGCGG - Intronic
900422219 1:2560572-2560594 TGAGGGCACCAGGCCAGGAGGGG - Intronic
900498453 1:2987734-2987756 TGATGGGAGGAGGCCAGGCAGGG - Intergenic
900990357 1:6095787-6095809 ACATGGGATCAGGCCAGGAGGGG - Intronic
901100411 1:6715237-6715259 ACAGGGCAGCTGGCCGGGCGGGG + Intergenic
901429611 1:9205199-9205221 AGATGGGTGGGGGCCAGGCGCGG - Intergenic
901490564 1:9594412-9594434 AGATGGGACCAGGCCCTGCGGGG - Intronic
901548476 1:9977379-9977401 AGATAACAACAGGCCAGGCATGG - Intronic
901587863 1:10313355-10313377 AGATGGTACTAGGCTAGGCGTGG - Intronic
901748225 1:11388781-11388803 AGATGGCGATGGGCCAGGCGCGG - Intergenic
901909145 1:12440583-12440605 TGAAGGAAGGAGGCCAGGCGCGG + Intronic
901941580 1:12666291-12666313 AGATGGCGTCACGCCAGGAGAGG - Exonic
902181417 1:14691780-14691802 AGATGAAGACAGGCCAGGCGAGG - Intronic
902251030 1:15154174-15154196 CGAGGCCAGCTGGCCAGGCGCGG - Intronic
902371258 1:16008500-16008522 AGGTGGCAGGAGGCCAGGCGCGG + Exonic
902758166 1:18563071-18563093 TGATGACATCAGGCCAGGCGTGG + Intergenic
902775464 1:18671691-18671713 AAATGGGAACAGGCCAGGCCTGG + Intronic
902882853 1:19384269-19384291 AGCTGGCAGAAGGCCAGAGGTGG - Intronic
902893688 1:19463887-19463909 TGAGGACAGCAGGCCAGGCACGG + Intronic
902941962 1:19806893-19806915 AGATTGAACCAGGCCAGGAGCGG + Intergenic
902968474 1:20029522-20029544 AGATGGGGGCATGGCAGGCGAGG + Intronic
903206389 1:21785452-21785474 AAAGGGGAGGAGGCCAGGCGCGG - Intergenic
903218658 1:21856705-21856727 AGGTGGGAGAAGGCCAGGAGCGG - Intronic
903497224 1:23777752-23777774 AGAACTCAGCAGGCCGGGCGCGG - Intergenic
903843761 1:26264240-26264262 AGAAGGTAGCAGGCTGGGCGCGG + Intronic
903923196 1:26815846-26815868 AAATGAAAGAAGGCCAGGCGCGG + Intergenic
903962240 1:27064515-27064537 ACAGGGCGGCTGGCCAGGCGGGG - Intergenic
904077661 1:27853660-27853682 ACAGGGCAGCTGGCCGGGCGGGG - Intergenic
904077915 1:27854231-27854253 ACAGGGCAGCTGGCCGGGCGGGG - Intergenic
904114732 1:28153453-28153475 AGAGCGCAGTAGGCCAGGCGTGG + Intronic
904125421 1:28235120-28235142 AGAAAAGAGCAGGCCAGGCGCGG - Intergenic
904183423 1:28683517-28683539 AGATGTCAACAGGCCGGGCATGG - Intronic
904507347 1:30969011-30969033 AGAGTGTAACAGGCCAGGCGTGG + Intronic
904667933 1:32138252-32138274 AGGTGGAAGCTGGCCAGGCGCGG + Intronic
904745651 1:32709109-32709131 AGAGGGCAGCAGGGGAGGCATGG + Intergenic
904801909 1:33099053-33099075 AGATGGGAAGAGGCCAGGCATGG - Intronic
905402637 1:37714762-37714784 AGATGGCCACAGGCAAGCCGGGG + Intronic
905698294 1:39992318-39992340 GGATGGCAGAAGGACAGGAGAGG + Intergenic
905870711 1:41402841-41402863 AGTAGGCACCAGGCCAGGCACGG + Intergenic
906378349 1:45315454-45315476 AGATGGATGCTGGCCAGGTGAGG + Intergenic
906411304 1:45581607-45581629 AGCTGGATGCAGGCCGGGCGCGG - Intergenic
906509175 1:46401105-46401127 AGGGGGAAGCAGGCCAGGGGAGG + Intronic
906509590 1:46403385-46403407 AGAAGAGAACAGGCCAGGCGCGG - Intronic
906686948 1:47769044-47769066 AGATGGAGGCTTGCCAGGCGGGG + Intronic
907168853 1:52441876-52441898 ATATGTCAGATGGCCAGGCGAGG + Intronic
907248535 1:53122970-53122992 AGAGGGCAGCAGGGCATGCCAGG - Intronic
908446245 1:64201484-64201506 ACGGGGCAGCTGGCCAGGCGGGG - Intergenic
908831855 1:68186919-68186941 AGTTAGCAGCTGGCCAGGCATGG + Intronic
909495184 1:76270214-76270236 AGTTGGCAACTGGCCAGGCACGG + Intronic
910212360 1:84806602-84806624 ATATAACATCAGGCCAGGCGCGG - Intergenic
910400533 1:86833778-86833800 AGATGGCAGCAGGCAACTCAGGG + Intergenic
911112543 1:94206604-94206626 ATATTGCAACAGGCCAGGTGTGG + Intronic
911553323 1:99311519-99311541 AGATGACATAAGGCCAGGCATGG + Intergenic
912298342 1:108489580-108489602 ACAGGGCGGCTGGCCAGGCGGGG + Intergenic
912421444 1:109544719-109544741 ACAGGGCAGCAGGCCAGGTTTGG + Exonic
912752045 1:112294148-112294170 ACAGGGCGGCTGGCCAGGCGGGG - Intergenic
912808178 1:112773945-112773967 ACAGGGCGGCTGGCCAGGCGGGG - Intergenic
912845038 1:113069878-113069900 ACATGGCGGCTGGCCGGGCGGGG - Intergenic
912918025 1:113837159-113837181 AGAAGGAAGCAGGCTAGGCGTGG + Intronic
913020187 1:114781254-114781276 AAATGAAAGTAGGCCAGGCGCGG - Intergenic
913047538 1:115087323-115087345 AGAAGGTAGGCGGCCAGGCGCGG + Intronic
913289979 1:117262936-117262958 AGATGGGAGCAGGACAAGAGGGG + Intergenic
913329552 1:117655863-117655885 AGTTGGCAGCAGGGCAAACGTGG + Intergenic
913360930 1:117979157-117979179 AGACGCCAGTAGGCCAGGCGCGG - Intronic
913452876 1:119003947-119003969 AGGTGGCAGCAGGCCTGGCTAGG + Intergenic
914735421 1:150411833-150411855 AGAAGGCAGTAGGCTAGGCGCGG + Intronic
914888206 1:151600864-151600886 ACAGGGCGGCTGGCCAGGCGGGG - Intergenic
914902185 1:151716696-151716718 AGCCGGCAGCAGCCCAGGCCCGG - Exonic
914987313 1:152472009-152472031 ATGGGGCAGCTGGCCAGGCGGGG + Intergenic
915137524 1:153743697-153743719 AGCTGGGAGCAGGCCTGGCTGGG + Intronic
915307243 1:154987644-154987666 AGAAGAAAGCAGGCCAGGCGTGG + Intronic
915488540 1:156238886-156238908 AGATGGCACCAGGCTTGGGGGGG - Intronic
915493042 1:156262204-156262226 AGAAGAAAGCAGGCCGGGCGCGG + Intronic
915494607 1:156272853-156272875 AGAGGTCAGTAGGCCGGGCGCGG - Intronic
915982042 1:160426348-160426370 AGAAGGCGGCAGGACAGGGGTGG - Exonic
916034646 1:160910910-160910932 TGATCACAGCAGGCCAGGCGCGG + Intergenic
916209967 1:162352347-162352369 AGGAGCCTGCAGGCCAGGCGCGG - Intronic
916509571 1:165460061-165460083 GGATGGCAGCAGGCAAAGAGAGG + Intergenic
916870870 1:168913465-168913487 AGACGGGCACAGGCCAGGCGTGG - Intergenic
916891109 1:169113355-169113377 AAACAGCAGCAGGCCAGGCATGG - Intronic
917868077 1:179217003-179217025 AGATGATTGGAGGCCAGGCGTGG + Intronic
918031160 1:180812937-180812959 AAATGGCTGCTGGCCGGGCGCGG - Intronic
918039904 1:180907736-180907758 AGCTGTCTGCAGGCCAGGAGGGG - Intergenic
918316374 1:183326083-183326105 ACAGGGGAGCAGGCCAGGCACGG + Intronic
919711419 1:200733202-200733224 AAATGGAAGGAGGCCGGGCGCGG - Intergenic
919740157 1:200976380-200976402 GAAAGGAAGCAGGCCAGGCGTGG - Intronic
919875686 1:201865496-201865518 AGACAGCTGCAGGCCGGGCGCGG - Intronic
919905910 1:202078228-202078250 AAACAGCAGCAGGCCGGGCGCGG - Intergenic
920236040 1:204506160-204506182 AAAAGGAAGCAGGCCGGGCGCGG + Intergenic
920370721 1:205477699-205477721 AGGGGGCAGCTGGCCAGGCCAGG - Intergenic
921644388 1:217597036-217597058 ATATGTCAACAGGCCAGGTGTGG + Intronic
921688398 1:218118486-218118508 AAATGGCCCCGGGCCAGGCGCGG - Intergenic
922305072 1:224337388-224337410 AGATGGTCTCAGGCCAGGCGCGG + Intergenic
922305687 1:224342190-224342212 AAATGGAAGCAGGCCAGGGGTGG - Intergenic
922567429 1:226610134-226610156 AAATGGCAGGAGGCAGGGCGGGG - Intergenic
922632977 1:227133353-227133375 ATGGGGCAGCTGGCCAGGCGGGG - Intronic
922693069 1:227710783-227710805 AGGGGGCGGCTGGCCAGGCGGGG + Intergenic
923446128 1:234072948-234072970 AGATGGTGGGAGGACAGGCGTGG + Intronic
923617360 1:235548900-235548922 AGAGGGAACTAGGCCAGGCGCGG + Exonic
924344246 1:243059287-243059309 AAGTGGCAGCTGGCCAGGTGTGG - Intergenic
924763598 1:247011139-247011161 ATGTGGCATCTGGCCAGGCGCGG - Intergenic
1063416731 10:5879181-5879203 AGATCCCACTAGGCCAGGCGCGG + Intronic
1064611258 10:17105089-17105111 ATATATCAGTAGGCCAGGCGTGG - Intronic
1064657460 10:17570143-17570165 AGAATACAGAAGGCCAGGCGTGG + Intergenic
1064664141 10:17632481-17632503 ATGTAGCAGAAGGCCAGGCGTGG + Intergenic
1065209742 10:23391066-23391088 AGATGTGAGCAGGGCAGGAGAGG - Intergenic
1065294160 10:24258881-24258903 AGATGTAAGCCGGCCGGGCGCGG - Intronic
1066204590 10:33175560-33175582 AGGTGGCAGCAGACCACGTGGGG + Intergenic
1066272936 10:33841176-33841198 AGATGGCTTGAGGCCAGGCATGG - Intergenic
1066326787 10:34368380-34368402 AGGTGAGAGCAGGCCGGGCGCGG + Intronic
1066389326 10:34966026-34966048 AGGTCCCTGCAGGCCAGGCGTGG - Intergenic
1067206240 10:44216243-44216265 GGATGGCAGCAGGCAAAGAGAGG - Intergenic
1067251322 10:44589334-44589356 AGATGCCAGCCAGCCTGGCGTGG + Intergenic
1067391202 10:45865482-45865504 ACGGGGCAGCTGGCCAGGCGGGG + Intergenic
1067494281 10:46747989-46748011 GCATGTGAGCAGGCCAGGCGCGG + Intergenic
1067600378 10:47592408-47592430 GCATGTGAGCAGGCCAGGCGCGG - Intergenic
1067776745 10:49169921-49169943 AGAAGGCAGGAGGACAGGGGAGG + Intronic
1067944609 10:50682162-50682184 GGATGGCCCCAGGCCAGGCAGGG - Intergenic
1068582630 10:58759667-58759689 AGAAGAGAGCAGGCCTGGCGCGG + Intronic
1069365812 10:67692081-67692103 AGGGGGCAGCTGGCCGGGCGGGG - Intronic
1069965419 10:72111195-72111217 AATTGGTATCAGGCCAGGCGTGG + Intronic
1070135542 10:73689997-73690019 ACAGGGCGGCTGGCCAGGCGGGG - Intronic
1070375835 10:75830529-75830551 GGATGGCAGCAGGCAAAGAGAGG + Intronic
1070577512 10:77690506-77690528 GGATGGCAGCAGGCTAGGGAGGG + Intergenic
1070759997 10:79018253-79018275 ACATGGCCACAGGCCAGGCACGG - Intergenic
1070866112 10:79709033-79709055 GGATGGCCCCAGGCCAGGCAGGG - Intronic
1070879905 10:79847164-79847186 GGATGGCCCCAGGCCAGGCAGGG - Intronic
1070955210 10:80459257-80459279 AGGAGGCAGCAGGCCAGGCCTGG + Intronic
1070966677 10:80534679-80534701 ACGGGGCAGCTGGCCAGGCGGGG - Intergenic
1071509177 10:86250611-86250633 ACAGGGCAGCTGGCCAGGCGGGG - Intronic
1071633015 10:87231254-87231276 GGATGGCCCCAGGCCAGGCAGGG - Intronic
1071646464 10:87363472-87363494 GGATGGCCCCAGGCCAGGCAGGG - Intronic
1071776964 10:88799885-88799907 AGATGGGAGGGGGCCGGGCGTGG - Intergenic
1072602205 10:96941164-96941186 ACAGGGCGGCTGGCCAGGCGGGG + Intronic
1072875812 10:99172206-99172228 AGATGGCAGCAGTACACGCTGGG - Intronic
1073349469 10:102809650-102809672 TGATGACAACAGGCCGGGCGTGG - Intronic
1073462534 10:103674529-103674551 ACATGGCACCAGGCTGGGCGCGG + Intronic
1073467954 10:103705148-103705170 AGGTCCCAGCAGGCCAGCCGTGG + Intronic
1073549588 10:104385524-104385546 AAATGGAATCAGGCCAGGTGTGG + Intronic
1073885863 10:108038913-108038935 AGATGGCACCAAGGCAGCCGTGG + Intergenic
1074538938 10:114349074-114349096 AGAGTGCAGAAGGCCAGGCTGGG + Intronic
1074595221 10:114857598-114857620 AGAAAGAAGAAGGCCAGGCGTGG - Intronic
1074798028 10:116969134-116969156 AGACTACCGCAGGCCAGGCGTGG + Intronic
1074891263 10:117738354-117738376 AGATGCCTGCAGGCCAGGCCTGG + Intergenic
1075096337 10:119474013-119474035 GGATGGCAGCAGGCAAAGAGGGG - Intergenic
1075396755 10:122133226-122133248 ACATGGCAGAAGGGCAGGGGCGG - Intronic
1075437319 10:122454664-122454686 AGATGGCAGCTGGCTTGGCAAGG + Exonic
1075867767 10:125741529-125741551 ATAAAACAGCAGGCCAGGCGTGG - Intronic
1076171131 10:128321038-128321060 AGATCACAACAGGCCAGGTGTGG - Intergenic
1076289591 10:129334855-129334877 AGATGGCAGCAGGCGAGAAAAGG - Intergenic
1076307305 10:129474312-129474334 TGGTGGCAGCAGGCCTGGCAGGG + Intronic
1076609834 10:131717196-131717218 AGTGGGCAAAAGGCCAGGCGTGG + Intergenic
1077001469 11:325312-325334 GGATGACTGCAGGCCAGGCCTGG + Intronic
1077052545 11:574109-574131 GGATGACTGCAGGCCAGGCCTGG - Intergenic
1077116916 11:889341-889363 AGATGGCAGCTGGTCGGCCGAGG - Intronic
1077213997 11:1387649-1387671 AGATGGCAGCAGGGAGGGCGCGG + Intergenic
1077430049 11:2511863-2511885 AGGGGGCTGCAGGCCAGGCCGGG - Intronic
1078337122 11:10473437-10473459 AGATTACAGTAGGCCAGGAGGGG + Intronic
1079225156 11:18598708-18598730 ATATCACAACAGGCCAGGCGCGG + Intergenic
1079357029 11:19738279-19738301 ACATGGCAACAGCCCAGGCAGGG + Intronic
1079397254 11:20075529-20075551 AAATGGAGACAGGCCAGGCGTGG - Intronic
1079583363 11:22094144-22094166 AGATGGCTGGTGGCCGGGCGTGG + Intergenic
1080337525 11:31215502-31215524 TGGAGGCAGCAGGCCTGGCGCGG + Intronic
1080473877 11:32571923-32571945 AGATGGGGAGAGGCCAGGCGCGG + Intergenic
1080967905 11:37234897-37234919 AGATGTGAGCAGGGCAGGAGAGG - Intergenic
1081138584 11:39470078-39470100 GGATGGCAGCAGGCAAAGAGTGG - Intergenic
1081200259 11:40206530-40206552 AAATGGCAATAGGCCAGGTGCGG - Intronic
1081289250 11:41305241-41305263 AGAGGGCGGCTGGCCGGGCGGGG - Intronic
1081606373 11:44529570-44529592 AGATGACTTCAGGCCAGGCGCGG + Intergenic
1081634401 11:44711315-44711337 AGAGGCCAGCAGGCCAGGCTGGG + Intergenic
1081756481 11:45548429-45548451 AAGTGGAAGGAGGCCAGGCGTGG + Intergenic
1081787083 11:45755472-45755494 GGAAGGCAGGAGCCCAGGCGGGG - Intergenic
1081873840 11:46395852-46395874 AGCTTCCAGCTGGCCAGGCGTGG - Intergenic
1082016224 11:47490224-47490246 AGATGGTATGAGGCCAGGCGTGG - Intronic
1082066656 11:47906277-47906299 AGGTGGCAGCAGGCTGGGCATGG + Intergenic
1082069104 11:47924280-47924302 AAGTGGTAGCAGGCCAGGCACGG - Intergenic
1082686763 11:56247286-56247308 AGATAGTACCAGGCCGGGCGCGG - Intergenic
1082986218 11:59172826-59172848 AGGTGGGAGCAGGCGGGGCGGGG - Intronic
1083234984 11:61345518-61345540 CCATGGCAGCAGACCAGGCTGGG - Exonic
1083372057 11:62190090-62190112 GGATGGCAGCAGCCCTGGCTAGG + Intergenic
1083440912 11:62675948-62675970 ATAAAGCAGCAGGCCGGGCGTGG + Intergenic
1083596703 11:63921041-63921063 AGGATGCAGCAGACCAGGCGCGG + Intergenic
1083623147 11:64058826-64058848 AGAGGGCAGCCGGCAAGGGGGGG + Intronic
1083640186 11:64141253-64141275 AGCTGGCACCAGGCCCGGCCAGG + Intronic
1083664377 11:64266616-64266638 ACGTGGCACCAGGCCAGGCATGG - Intronic
1083685973 11:64375353-64375375 AGTTAACAGCAGGCCAGGAGCGG - Intergenic
1083841739 11:65308704-65308726 AGTTGGCAGGAGTCCAGGGGAGG + Intergenic
1083962946 11:66024568-66024590 ACATGACAACAGGCCAGGCGCGG - Intronic
1084050504 11:66596355-66596377 AGTTGTCAGATGGCCAGGCGTGG - Intronic
1084973921 11:72786059-72786081 AGGGTGCAGCAGGCCGGGCGCGG + Intronic
1085066664 11:73501809-73501831 AGCTAGCAGAAGGCCGGGCGCGG + Intronic
1085387642 11:76166170-76166192 AGATGGCATGAGGCCAGGAGTGG - Intergenic
1085392669 11:76190387-76190409 AGATGGAACCAGGTCAGGCCAGG - Intronic
1085814078 11:79717210-79717232 AGAAGGCAGGAAGCCAGGCAGGG - Intergenic
1086371550 11:86160290-86160312 AAATTGCAGAAGGCCAGGTGCGG + Intergenic
1086526871 11:87738156-87738178 AAATAAGAGCAGGCCAGGCGTGG + Intergenic
1087035871 11:93755873-93755895 ATATGGCTGGAGGCCAGACGCGG + Intronic
1087177597 11:95109707-95109729 AGCAGGTAGCAGGCCAGGTGTGG - Intronic
1087419785 11:97907408-97907430 AGATGTCAGAAGGTAAGGCGTGG + Intergenic
1087506532 11:99031085-99031107 AGTTAGCATTAGGCCAGGCGTGG - Intronic
1087775887 11:102256222-102256244 AGATAGCATCAGGCCGGGCACGG - Intergenic
1089035092 11:115381008-115381030 AGGTGGTAACAGGCCAGGCAAGG + Intronic
1089161951 11:116445123-116445145 AAATGCCAGTAGGCCAGGCAGGG - Intergenic
1089420892 11:118331388-118331410 ATGGGGCAGCTGGCCAGGCGGGG + Intergenic
1089431015 11:118424552-118424574 AGATAGCCAGAGGCCAGGCGCGG + Intronic
1089524336 11:119086969-119086991 AAATGGGATCAGGCTAGGCGTGG + Intronic
1089615331 11:119691830-119691852 AGCTGGGAGCAGGGCAGGCCAGG - Intronic
1089811876 11:121138719-121138741 TGATGTCTGCAGGCCAGACGAGG - Intronic
1090769689 11:129909018-129909040 AGAGTGGAGCGGGCCAGGCGTGG - Intronic
1091459286 12:631649-631671 AGGTAGAGGCAGGCCAGGCGCGG - Intronic
1091629851 12:2151735-2151757 AGATGACAGCAGGCCACTCTCGG + Intronic
1092154659 12:6274400-6274422 AGATGGCCGCTGTCCAGGAGGGG + Intergenic
1092167294 12:6350140-6350162 AAATGGGAACAGGCCGGGCGTGG + Intronic
1092348845 12:7739399-7739421 AGAATGAAACAGGCCAGGCGCGG - Intronic
1092800561 12:12161559-12161581 AGAAGTCAACAGGCCGGGCGTGG - Intronic
1093886626 12:24468839-24468861 AGATGGAAATAGGCCAGGCATGG - Intergenic
1094369755 12:29725315-29725337 AGATCTTGGCAGGCCAGGCGTGG - Intronic
1094451160 12:30584411-30584433 AGATGGTGTCAGGCCAGGCACGG + Intergenic
1094589786 12:31809421-31809443 GGAGGGAAGCAGGCCAGGGGAGG - Intergenic
1094666930 12:32529413-32529435 TAATGGAAGTAGGCCAGGCGCGG - Intronic
1094705032 12:32906321-32906343 AGTAAGAAGCAGGCCAGGCGTGG - Intergenic
1095211615 12:39501192-39501214 AGATAGGAGCAGGACAGGAGAGG - Intergenic
1095498864 12:42814686-42814708 AAATGGCCCTAGGCCAGGCGCGG - Intergenic
1095954085 12:47796712-47796734 AGAAAGCAGGAGGCCGGGCGCGG - Intronic
1096376152 12:51112574-51112596 AGATTGATGCAGGCCAAGCGTGG + Intronic
1096376372 12:51114771-51114793 AGAAAGCAACAGGCCAGGTGTGG + Intronic
1096437682 12:51608298-51608320 AATTGGTACCAGGCCAGGCGCGG - Intronic
1096482324 12:51951225-51951247 GGATGGCAGGGGGCGAGGCGAGG + Intergenic
1096503310 12:52078647-52078669 AGACTGCAGCAGGCCAAGTGGGG - Intergenic
1096615570 12:52831382-52831404 TGAGGAGAGCAGGCCAGGCGGGG - Intronic
1096745475 12:53724184-53724206 TGAAAGCTGCAGGCCAGGCGTGG - Intronic
1097280976 12:57845551-57845573 GGATGGCATCAGACCCGGCGTGG - Intronic
1097892115 12:64787743-64787765 AGATTGCTGCAGGCCGGGCATGG + Intronic
1097975259 12:65679065-65679087 TGATAGCAGGAGGCCAGGCGTGG + Intergenic
1098050063 12:66443744-66443766 ATATTGCAGTAGGCCAGGCATGG - Intronic
1099060342 12:77900364-77900386 AGATGAGAACAGGCCAGGTGTGG - Intronic
1099167484 12:79324238-79324260 AAATGGAAACAGGCCAGGCGCGG - Intronic
1099590419 12:84580096-84580118 AGATACACGCAGGCCAGGCGTGG + Intergenic
1099852477 12:88119506-88119528 AGATTTTAACAGGCCAGGCGCGG + Intronic
1100432400 12:94542337-94542359 AAGAGGCAGGAGGCCAGGCGTGG + Intergenic
1100485430 12:95021356-95021378 AGACAGCAGTAGGCCAGGCACGG + Exonic
1100590638 12:96024956-96024978 AGATCCCAAAAGGCCAGGCGTGG - Intronic
1100878962 12:98995298-98995320 ATATGGAAGCTGGCCAGGCATGG + Intronic
1100999948 12:100347234-100347256 AGGTAGAAGCAGGCCAGGCGCGG - Intergenic
1101644199 12:106613652-106613674 ATATTGATGCAGGCCAGGCGTGG - Intronic
1102149737 12:110680436-110680458 AAATGGCAGCAGGTCAAGCTGGG - Intronic
1102174938 12:110867727-110867749 ACAGGGCGGCTGGCCAGGCGGGG + Intronic
1102186520 12:110951795-110951817 AGATGGCAGCAGCACAGTCCAGG + Intergenic
1102283711 12:111638185-111638207 AGATAAAAGCAGGCCAGGCATGG - Intergenic
1102364705 12:112322213-112322235 TGATGGAAGAAGGCCAGGTGTGG + Intronic
1102458414 12:113085343-113085365 AAATGGGAGCAGGCCTGGCTGGG - Intronic
1102504307 12:113374162-113374184 AGTTGGCAAGAGGCCAGGCCAGG + Intronic
1102828964 12:115977704-115977726 AGATCGCATATGGCCAGGCGAGG + Intronic
1103088013 12:118076947-118076969 AGAAGGGAGAAGGCCGGGCGTGG - Intronic
1103294300 12:119873086-119873108 AGGAGGCAACAGGCCAGGTGTGG - Intronic
1103782904 12:123411347-123411369 AGATGACTGCTGGCCAGGCACGG + Exonic
1103841627 12:123869880-123869902 GGAAGGCAGCAACCCAGGCGGGG - Intronic
1103901882 12:124307604-124307626 AGATGGGAGGAGGCCAGGCTGGG + Intronic
1104029395 12:125053576-125053598 ACAGGGCAGCTGGCCGGGCGGGG + Intergenic
1104626503 12:130360343-130360365 AGCTGGATTCAGGCCAGGCGTGG + Intronic
1104715499 12:131013475-131013497 AGATGCCAGAAGGCGAGGTGGGG - Intronic
1104828120 12:131729211-131729233 GGTTCACAGCAGGCCAGGCGTGG + Intronic
1104830145 12:131744869-131744891 GGATGGCAGCAGGCAAAGAGAGG + Intronic
1105047724 12:133019803-133019825 AAATGAAATCAGGCCAGGCGTGG + Exonic
1105452152 13:20509635-20509657 AGATGCCATTAGGCCAGGCTTGG + Intronic
1105992615 13:25637540-25637562 AGATGGCAGCAAGCTTGGGGTGG + Intronic
1106471579 13:30060667-30060689 AGAAAGCAGCAGGCAAGGCAAGG - Intergenic
1106510370 13:30407983-30408005 ATATTACAGAAGGCCAGGCGCGG + Intergenic
1106843064 13:33707542-33707564 AGGTGCCAGAAGGCCAGGTGTGG - Intergenic
1106912613 13:34479110-34479132 AGGTGGCAGCAGGCTTGGCCAGG + Intergenic
1106918791 13:34541129-34541151 ACAGGGCGGCTGGCCAGGCGGGG - Intergenic
1107267899 13:38579311-38579333 AGATGGCAGGGGCCCAGGTGCGG - Intergenic
1107355553 13:39561743-39561765 CCATGGCACCAGGCCAGGAGTGG + Intronic
1107506393 13:41038197-41038219 AAATGGAATCAGGCCAGGTGAGG + Intronic
1107855371 13:44610415-44610437 AGATGACTGGAGGCCAGGCACGG + Intergenic
1107860333 13:44654681-44654703 AGAGGAATGCAGGCCAGGCGCGG + Intergenic
1107989247 13:45802779-45802801 AGGCAGCTGCAGGCCAGGCGTGG + Intronic
1108084200 13:46767821-46767843 AAGTGGCTGTAGGCCAGGCGTGG - Intergenic
1108502066 13:51078204-51078226 ACAGGGCGGCTGGCCAGGCGGGG - Intergenic
1108675761 13:52736417-52736439 GGTGGGCTGCAGGCCAGGCGTGG - Intronic
1109192363 13:59340934-59340956 AGCTGCAAGTAGGCCAGGCGTGG + Intergenic
1109377397 13:61514857-61514879 TAATAGCAGCAGGCCAGGCATGG + Intergenic
1109713579 13:66190181-66190203 AGATGCCAGCTGTCCAGGCCTGG + Intergenic
1110196277 13:72792003-72792025 TGGAGGCAGGAGGCCAGGCGCGG + Intronic
1110437245 13:75488955-75488977 AGATGTCTTAAGGCCAGGCGTGG + Intergenic
1110443585 13:75551137-75551159 AGAGGGGAGACGGCCAGGCGCGG + Intronic
1110710519 13:78645938-78645960 ATATGACTACAGGCCAGGCGCGG - Intronic
1111046664 13:82823042-82823064 AGAAGGCAGCAGGGCCAGCGAGG - Intergenic
1111198564 13:84905140-84905162 AGAAGGCAGCATGGCAGGAGTGG - Intergenic
1111493632 13:89019081-89019103 TAATGGCAAGAGGCCAGGCGCGG - Intergenic
1111703331 13:91717843-91717865 ATGTGCAAGCAGGCCAGGCGCGG - Intronic
1112305106 13:98266719-98266741 GGATGGCATGAGGCCGGGCGTGG + Intronic
1112438882 13:99410834-99410856 AAATGGCTGTAGGCCAGGTGCGG - Intergenic
1112695622 13:101945023-101945045 AAATGGTTACAGGCCAGGCGCGG + Intronic
1113338148 13:109396561-109396583 AGATAGGAGACGGCCAGGCGCGG + Intergenic
1113747072 13:112752531-112752553 CGATGGCAGCAGGCTGGGGGTGG - Intronic
1114279229 14:21175660-21175682 AGGTAACAGCAGGCCAGGTGTGG + Intergenic
1114465785 14:22921592-22921614 AGATAAGATCAGGCCAGGCGCGG + Intronic
1114537022 14:23429383-23429405 AGATGACTGCTGGCCAGGTGTGG + Intronic
1114854670 14:26423932-26423954 ATATGGTAGCAGGCTGGGCGCGG + Intergenic
1115225978 14:31102718-31102740 AACTGACAGCAGGCCGGGCGCGG - Intronic
1115541105 14:34422210-34422232 AGATGACACCTGGCCAGACGCGG + Intronic
1115696943 14:35909437-35909459 AAATAGCCTCAGGCCAGGCGCGG - Intronic
1116024432 14:39497860-39497882 GGATGGCAGCAGGCAAAGAGAGG - Intergenic
1116891974 14:50277483-50277505 TGGTGGCAGAGGGCCAGGCGTGG + Intronic
1116917087 14:50535980-50536002 CGATGGCAGCAGGCAAAGAGAGG - Intronic
1117004242 14:51402485-51402507 GGATGGCAGCAGGCAAAGAGAGG - Intergenic
1117117266 14:52526978-52527000 GGAGGGCAGCATGCCAGGGGAGG + Intronic
1117125347 14:52617386-52617408 AGATGGAAACTGGCCGGGCGCGG + Intronic
1117142561 14:52804551-52804573 AAAAAGCAGCAGGCCAGGCGCGG + Intergenic
1117144831 14:52827114-52827136 AGATGCCTTCTGGCCAGGCGTGG + Intergenic
1117326653 14:54675073-54675095 AGAAAGCAGAAGGCCAGGCATGG + Intronic
1118897866 14:69961664-69961686 AAATGGAAACAGGCCAGGCGTGG - Intronic
1119459515 14:74788408-74788430 ATGTGACAGAAGGCCAGGCGCGG - Intronic
1119886451 14:78147401-78147423 AGATCCTAGCAGGCCAGACGGGG + Intergenic
1119993560 14:79227106-79227128 AAATGGATGTAGGCCAGGCGCGG - Intronic
1121039545 14:90734126-90734148 AGGAGGAAACAGGCCAGGCGTGG + Intronic
1121142714 14:91557138-91557160 ACAGGGCAGCTGGCCGGGCGGGG + Intergenic
1121233197 14:92373332-92373354 TGACAGCAGCTGGCCAGGCGTGG - Intronic
1121521517 14:94589154-94589176 AGTTGGAAACAGGCCAGGCATGG + Intronic
1121668684 14:95691798-95691820 AGCTTGGAGCAGGCCAGGCAGGG + Intronic
1121671150 14:95711638-95711660 AGATGGCAGCAGTCGGGGAGGGG + Intronic
1121822370 14:96981814-96981836 AGAGGGCTGCAGGACAGGCGAGG - Intergenic
1121962741 14:98276230-98276252 AGATGGCATCAGGACAAGAGGGG - Intergenic
1122135634 14:99631359-99631381 AAATGGAACCAGGCCGGGCGCGG - Intergenic
1122158953 14:99769006-99769028 ATATACAAGCAGGCCAGGCGTGG - Intronic
1122221249 14:100240100-100240122 AGATGGCGGCAGGCCGCGGGGGG + Intronic
1122334387 14:100960325-100960347 AGATGGCAGCATGCCTGGCAGGG - Intergenic
1122474926 14:102000861-102000883 AAATGGTTTCAGGCCAGGCGCGG - Intronic
1122626707 14:103088701-103088723 GGCTGAAAGCAGGCCAGGCGCGG + Intergenic
1122768711 14:104087519-104087541 AGATGGGAGAGGGCCAGGCCAGG + Intronic
1122834437 14:104424008-104424030 TGATGGCACCAGGCCACGCCTGG - Intergenic
1122868431 14:104621485-104621507 AGAAAGCAAGAGGCCAGGCGCGG + Intergenic
1122911882 14:104833822-104833844 AAATGACAGGAGGCCGGGCGCGG - Intergenic
1123195793 14:106615457-106615479 AGATGGCAGCAGACAAAGAGAGG + Intergenic
1123198081 14:106636067-106636089 ACATGGCAGCAGGAGAGGTGGGG - Intergenic
1123448836 15:20347842-20347864 ATGTGGCAACAGGCCAGGCGTGG + Intergenic
1123694101 15:22864442-22864464 AGAGGACAGCAGGCCGGGCGTGG - Intronic
1124012194 15:25847920-25847942 AAATGGCTGTAGGCCAGGTGTGG - Intronic
1124895154 15:33769661-33769683 AGAGAGACGCAGGCCAGGCGCGG + Intronic
1125079382 15:35656555-35656577 ACAGGGCAGCTGGCCGGGCGGGG - Intergenic
1125205877 15:37153230-37153252 AGATGGAAGTAGGCCAGACGCGG + Intergenic
1125570529 15:40713894-40713916 ATATGGCAGCCAGCCAGGCACGG - Intronic
1125685382 15:41560363-41560385 ACATGCCAGGAGGCCAGGAGAGG + Intronic
1125832323 15:42725700-42725722 AGATGGGGGCAGGCCGGGTGCGG + Intronic
1125853717 15:42928705-42928727 AGAAAACAGGAGGCCAGGCGAGG - Intergenic
1125862909 15:43014938-43014960 ACAGGGCAGCTGGCCGGGCGGGG - Intronic
1126077005 15:44921331-44921353 GTATGGTAGCAGGCCAGGCATGG - Intergenic
1126525458 15:49649444-49649466 AGAAGTCAGCAGGCCAGGCGCGG + Exonic
1126691911 15:51294595-51294617 ACAGGGCAGCTGGCCGGGCGGGG - Intronic
1127824212 15:62689907-62689929 ACGGGGCAGCTGGCCAGGCGGGG + Intronic
1128019620 15:64379184-64379206 AAATTTCATCAGGCCAGGCGTGG + Intronic
1128498258 15:68210419-68210441 AGATGGCAGGAGGCCTGTCCAGG + Intronic
1128626894 15:69217863-69217885 GGAACACAGCAGGCCAGGCGCGG + Intronic
1129090863 15:73148937-73148959 AGATGGAAGCAGGGCAGGGTAGG + Intronic
1129508338 15:76101816-76101838 TGTTGGCAGCTGGCCAGGCGTGG - Intronic
1129672644 15:77615833-77615855 GGCTGCCAGCAGGCCAGGAGGGG + Exonic
1129692631 15:77722380-77722402 AGATGGCAGGAGGCAAGCTGGGG + Intronic
1129701442 15:77770814-77770836 GGATGGCAGCCTGCCAGGCCAGG - Intronic
1130200014 15:81816910-81816932 AGAATACAGCTGGCCAGGCGCGG - Intergenic
1130345191 15:83037790-83037812 AGATTCCACCAGGCCAGGTGCGG + Intronic
1130408585 15:83624968-83624990 AGAGAGCACCAGGCCAGGCACGG + Intergenic
1130830429 15:87593098-87593120 AGATGACAGCAGGAGAGGGGAGG - Intergenic
1131005322 15:88972964-88972986 AATTGGCAGCAGGCCAAGCACGG - Intergenic
1131007290 15:88988203-88988225 TGAGGGCACCAGGCCAGGCAAGG + Intergenic
1131127318 15:89868178-89868200 ACGGGGCAGCTGGCCAGGCGGGG - Intronic
1131236486 15:90701426-90701448 AGATGACAGCAGGTCAGGCGTGG + Intergenic
1131268117 15:90930657-90930679 AGTTGGAAGGGGGCCAGGCGCGG - Exonic
1131275644 15:90978459-90978481 ATGTGCCATCAGGCCAGGCGTGG + Intronic
1131632380 15:94193103-94193125 AAATAGCATCAGGCCGGGCGCGG + Intergenic
1131709057 15:95033285-95033307 AGAAGGGCCCAGGCCAGGCGTGG + Intergenic
1132131872 15:99289641-99289663 AAATGGCACCAGGCCGGGCGCGG + Intronic
1132486461 16:194654-194676 GGAGGACAGCAGGCCAGGGGAGG + Intronic
1132649886 16:1015754-1015776 AGCAGGCTGCAGGCCAGGCGCGG + Intergenic
1132697505 16:1208518-1208540 AGCAGACGGCAGGCCAGGCGGGG + Intronic
1132788208 16:1669972-1669994 AACTGGAAACAGGCCAGGCGTGG + Intronic
1132815437 16:1823998-1824020 GGAGGGCAGATGGCCAGGCGGGG - Intronic
1132944628 16:2526187-2526209 AGGTGTCAGCAGGCCAGCTGGGG + Intronic
1133288062 16:4700125-4700147 GCATGGCACCAGGCCAGGTGTGG + Intronic
1133304367 16:4800435-4800457 AGGCGGCAGCAGGCCTGCCGCGG - Intronic
1133332772 16:4986428-4986450 ACGTGGTAGCAGGCCAGGTGTGG - Intronic
1133497149 16:6329639-6329661 AGATGGATGAAGGCCAGGCATGG + Intronic
1133514519 16:6495419-6495441 AGATGGCTGTCTGCCAGGCGCGG - Intronic
1133976360 16:10602128-10602150 AGATGGGAGCAGGCCACACCTGG + Intergenic
1134118386 16:11566471-11566493 ATTTGGGAGCAGGCCAGACGTGG + Intronic
1134412845 16:14017344-14017366 AGACTGCAGCAGGCCGGGCGCGG - Intergenic
1134449093 16:14352832-14352854 AAAAGGGAACAGGCCAGGCGTGG - Intergenic
1134480755 16:14617092-14617114 AGATCACAGTAGGCCAGGCGTGG + Intronic
1134657518 16:15958398-15958420 AAAAGGCAACAGGCCAGGCACGG - Intronic
1134834011 16:17346383-17346405 TGAACGCAGCAGGCCAGGTGGGG + Intronic
1134878950 16:17727580-17727602 GGATGAGATCAGGCCAGGCGCGG + Intergenic
1135069601 16:19340420-19340442 GGAGGACAGGAGGCCAGGCGCGG - Intergenic
1135277639 16:21127260-21127282 AGAGGACACGAGGCCAGGCGCGG + Intronic
1135878398 16:26227593-26227615 AAAGAGTAGCAGGCCAGGCGCGG - Intergenic
1135959921 16:26986908-26986930 AGAGAGCTCCAGGCCAGGCGCGG + Intergenic
1136023710 16:27456500-27456522 CGATGGCCCCAGGCCAGGCGTGG + Intergenic
1136243598 16:28959856-28959878 TGAATGCAGCAGGCCAGGCGCGG - Intronic
1136465388 16:30439574-30439596 ACAAGGAAGCAGGCCAGGTGCGG - Intergenic
1136516405 16:30771325-30771347 ACCAGACAGCAGGCCAGGCGTGG + Intronic
1137001971 16:35237002-35237024 AGAGGACAGTAGGCAAGGCGGGG - Intergenic
1137003769 16:35253627-35253649 AGATTACATGAGGCCAGGCGTGG + Intergenic
1137067447 16:35863225-35863247 AGATGGCAGAAGGTGAGGTGTGG - Intergenic
1137259328 16:46811211-46811233 AGAGAGAAGCAGGCCAGGCGCGG + Intronic
1137283900 16:47000340-47000362 ACAGGGCGGCTGGCCAGGCGGGG - Intergenic
1137387935 16:48058159-48058181 AGATGTCATGAGGCCGGGCGCGG - Intergenic
1137476897 16:48817134-48817156 CGAAGGCAGCAGGCCAGGCACGG - Intergenic
1137500833 16:49010680-49010702 GGAGGGCAGCAGGCAAGGTGGGG - Intergenic
1138105548 16:54285685-54285707 AGAGGGGTGCAGGCCAGGAGGGG - Intronic
1138122856 16:54414422-54414444 TGATGACCTCAGGCCAGGCGCGG - Intergenic
1138316719 16:56076643-56076665 AGAAAGCAGAAGGCCAGGCGCGG + Intergenic
1138481094 16:57303934-57303956 GGAGGGCAGCAGGCAGGGCGGGG - Intergenic
1138497634 16:57417837-57417859 AGTTTGCTGGAGGCCAGGCGCGG - Intergenic
1138515629 16:57534201-57534223 AGATGGCAGCTTGCCAGGCTTGG - Intronic
1138575554 16:57905156-57905178 AGTTGGCAGGAGGCCAGACCAGG + Intronic
1138895378 16:61198288-61198310 GGATGGCAGCAGGCAAAGAGAGG + Intergenic
1139158594 16:64475460-64475482 TGATGGCCACAGGCCAGGTGTGG + Intergenic
1139162453 16:64527632-64527654 ATATGGCAGCAGGCAAAGAGAGG - Intergenic
1139424093 16:66868297-66868319 AGAGGGCAGAGGGCCGGGCGCGG + Intronic
1139494662 16:67307604-67307626 AGCTGGCTGTCGGCCAGGCGTGG - Intronic
1139527218 16:67524512-67524534 AGAAGGCAGCTGGACAGGCAGGG - Intronic
1139709408 16:68764284-68764306 AAATGGGAGCTGGCCAGGCATGG + Intronic
1139788635 16:69414214-69414236 AGTTGGAGGCAGGCCAGGTGCGG - Intergenic
1139854909 16:69972524-69972546 AGATGACACCAGGACAGGGGAGG + Intergenic
1139864440 16:70051693-70051715 ACAGGGCAGCTGGCCGGGCGGGG - Intergenic
1139883904 16:70195418-70195440 AGATGACACCAGGACAGGGGAGG + Intergenic
1139914720 16:70420997-70421019 AGATGGCACCAGGCTGGCCGTGG - Intronic
1140051471 16:71485157-71485179 CCAGGTCAGCAGGCCAGGCGCGG + Intronic
1140085248 16:71790248-71790270 AGACTGAAGCAGGCCAGGCACGG + Intronic
1140311663 16:73855158-73855180 AAATGGCTGCAGGCAAGGAGGGG - Intergenic
1141142165 16:81503685-81503707 ATGGGGCAGAAGGCCAGGCGCGG - Intronic
1141432421 16:83977309-83977331 AGGTGGCTGCAGGGCAGGTGGGG + Intronic
1141624777 16:85255306-85255328 AGAAGGCAGCGGGTCAGGCTGGG - Intergenic
1141643788 16:85356780-85356802 AAATGGATACAGGCCAGGCGCGG - Intergenic
1141957493 16:87382922-87382944 AAATGGGAGCAGGCCGGGCGCGG - Intronic
1142106543 16:88306664-88306686 AGACGCCTCCAGGCCAGGCGTGG + Intergenic
1142224545 16:88871177-88871199 AGCTGACAGCTGGCCTGGCGGGG + Intergenic
1142245842 16:88969703-88969725 TCAGGGCAGCAGGCCAGGCTTGG + Intronic
1142264414 16:89057214-89057236 AGGAGGCAGCAGGCCCAGCGGGG + Intergenic
1142434912 16:90050150-90050172 AGATGCCAGGAGGTCAGGCATGG - Intergenic
1142702321 17:1670775-1670797 TGATGAGAGCAGGCCAGGCGCGG - Intronic
1142734463 17:1887265-1887287 AGATCACTGTAGGCCAGGCGCGG + Intronic
1142892162 17:2950899-2950921 AAATTGAAGCAGGCCGGGCGCGG - Intronic
1142988154 17:3710134-3710156 AGACTGCAGGAGGCCGGGCGTGG + Intergenic
1142988211 17:3710635-3710657 AGACAGCAGGAGGCCGGGCGTGG + Intergenic
1143005980 17:3834483-3834505 TGCTGACAGCAGGCTAGGCGCGG + Intronic
1143024029 17:3930458-3930480 AGAGAGCGGCAGGTCAGGCGAGG + Intronic
1143664685 17:8350314-8350336 ATATGTCCACAGGCCAGGCGTGG - Intergenic
1143846689 17:9777403-9777425 AGATTGCAGCAGGGCAGAGGTGG + Intronic
1144217323 17:13067949-13067971 AGATGGCTGCAGGACCGGCTTGG + Intergenic
1144476544 17:15593917-15593939 AAATGACAGCAGGCCGGGCATGG - Intronic
1144921708 17:18769484-18769506 AAATGACAGCAGGCCGGGCATGG + Intronic
1145996483 17:29107624-29107646 AAAAGACACCAGGCCAGGCGTGG + Intronic
1146387931 17:32394114-32394136 AAAAGAAAGCAGGCCAGGCGCGG + Intergenic
1146560420 17:33864195-33864217 AGAAGGTAACTGGCCAGGCGGGG - Intronic
1146804040 17:35850962-35850984 GGAGGTAAGCAGGCCAGGCGCGG + Intronic
1146930211 17:36771682-36771704 AGATGGCAGCAGGCCGGGAGAGG + Intergenic
1146995674 17:37318529-37318551 AAAATGCAGGAGGCCAGGCGCGG - Intronic
1147309894 17:39589272-39589294 AGATTGCCTCAGGCCAGGTGCGG + Intergenic
1147328964 17:39685185-39685207 ACGTACCAGCAGGCCAGGCGCGG + Intronic
1147836398 17:43335177-43335199 AGATGACTGCAGGGCAGGCCTGG + Intergenic
1148103221 17:45105324-45105346 AGAGGGCAGCAGCTCAGGAGAGG - Intronic
1148299520 17:46534801-46534823 AGGGGGCGGCTGGCCAGGCGGGG + Intronic
1148303618 17:46568512-46568534 AGAGGGGGGGAGGCCAGGCGAGG + Intronic
1148427086 17:47608162-47608184 AAAGGGAATCAGGCCAGGCGTGG + Intronic
1148463052 17:47849069-47849091 CGATGTGACCAGGCCAGGCGGGG - Intronic
1148586845 17:48787117-48787139 AGATGATGACAGGCCAGGCGCGG - Intronic
1148772332 17:50074606-50074628 GGATGTCAGGAGGCCAGGGGAGG - Intronic
1148784262 17:50137802-50137824 AGGTGGCAGCATGCCTGTCGGGG - Intronic
1149645373 17:58237296-58237318 AGAAGGCAGCTGTCCAGGAGAGG - Intronic
1149780584 17:59394118-59394140 ACGCGGCAGCTGGCCAGGCGGGG + Intronic
1149799035 17:59549221-59549243 TGGAGGCTGCAGGCCAGGCGGGG - Intergenic
1149950215 17:60977126-60977148 ACAGGGCGGCTGGCCAGGCGGGG + Intronic
1149976349 17:61270093-61270115 AAATGGCAGAAGGCCATGCCTGG - Intronic
1150350841 17:64443275-64443297 AGGTGTCGTCAGGCCAGGCGAGG - Intergenic
1150383627 17:64740283-64740305 AAATGTCTCCAGGCCAGGCGCGG + Intergenic
1150617102 17:66780815-66780837 ATAGGGCTTCAGGCCAGGCGTGG + Intronic
1150618825 17:66793297-66793319 AGAGGCCTGTAGGCCAGGCGTGG + Intronic
1150805453 17:68315249-68315271 AAAGAGCAGGAGGCCAGGCGTGG + Intronic
1150843666 17:68633341-68633363 ATATGAAAGCAGGCCGGGCGTGG - Intergenic
1151428266 17:74045345-74045367 AGATAGCAACAAGCCAGGTGCGG - Intergenic
1151630830 17:75309696-75309718 AGATGGCTGCAGGGCAGTGGGGG - Intergenic
1151699034 17:75732794-75732816 ATGGGACAGCAGGCCAGGCGAGG + Intronic
1151934792 17:77255134-77255156 AGTTGGCACCTGGCCAGGTGAGG + Intergenic
1151996729 17:77614100-77614122 AGAAGAAAGCTGGCCAGGCGCGG + Intergenic
1152174547 17:78779108-78779130 AAAGGGGAACAGGCCAGGCGGGG + Intronic
1152419896 17:80186838-80186860 AGGAGGCAGGAGGCCGGGCGTGG - Intronic
1152437078 17:80282986-80283008 ATATTGAATCAGGCCAGGCGTGG - Intronic
1152446851 17:80349915-80349937 AGAGGGCAGCAGGGAAGGCAGGG - Intronic
1152524416 17:80879395-80879417 AGGTGGGGGCAGGGCAGGCGGGG - Intronic
1152690159 17:81714285-81714307 AGCTCTCAGCTGGCCAGGCGAGG + Intronic
1152737125 17:82002846-82002868 AGATGAAAACAGGCCGGGCGCGG - Intronic
1153475822 18:5497357-5497379 GGATGGCAACAGTCCAGGTGAGG + Intronic
1154139795 18:11812963-11812985 AGATGTAAGTAGGCCAGGTGTGG + Intronic
1154240600 18:12650266-12650288 AAGTGACAGCAGGCCAGGCATGG + Intronic
1154244562 18:12684403-12684425 AGGTGACAGCAGGCCAGGCATGG - Intronic
1154930678 18:20991926-20991948 AAGTGGTAGCAGGCCAGGCAAGG - Intronic
1155388904 18:25312520-25312542 AGTTGGAACCAGGCCGGGCGCGG + Intronic
1155860451 18:30891288-30891310 AGATAGAAAGAGGCCAGGCGTGG + Intergenic
1155943289 18:31821220-31821242 AGAAGACAACAGGCCAGGCATGG - Intergenic
1156116749 18:33794784-33794806 AGAGGGGAGGAGGCCAGGTGCGG - Intergenic
1156276317 18:35586112-35586134 AAATGGTGACAGGCCAGGCGTGG - Intronic
1157452579 18:47799660-47799682 AGATGGCAACAGGCATGGCAGGG - Intergenic
1157607625 18:48935786-48935808 ACACAGCAGAAGGCCAGGCGTGG + Intronic
1157694013 18:49706376-49706398 AGATTTCAGCAGGCCAGGCACGG + Intergenic
1157893215 18:51438645-51438667 AGAGGGCAGGAGGCCAGGGATGG + Intergenic
1158368098 18:56763234-56763256 ACATCGAAGAAGGCCAGGCGTGG - Intronic
1158595114 18:58809134-58809156 ACAGGGGAGCAGGCCAGGTGCGG + Intergenic
1158646952 18:59255855-59255877 ACGGGGCAGCTGGCCAGGCGGGG - Intergenic
1159356644 18:67345174-67345196 AAAGGTCAGTAGGCCAGGCGTGG - Intergenic
1160448785 18:78947626-78947648 AGAAGGGAGCTGGCCAGGCAGGG + Intergenic
1160751554 19:736757-736779 AGAAGGCAGAGGGCCGGGCGTGG + Intronic
1160832146 19:1109078-1109100 AGATGGCGGCGACCCAGGCGGGG - Intronic
1160920737 19:1519070-1519092 AGATGGGAAGGGGCCAGGCGCGG + Intergenic
1161367037 19:3885944-3885966 AGATGGAACCAGGCCAGCCCCGG - Intronic
1161518698 19:4711480-4711502 AGAGGGAGGCAGGCCAGGCACGG + Intronic
1161540704 19:4849584-4849606 ACATGGGATGAGGCCAGGCGTGG - Intronic
1161541558 19:4854822-4854844 AGCTCACAGCAGGCCAGGCACGG + Intronic
1161687113 19:5708308-5708330 TGCGGGCAGCTGGCCAGGCGGGG - Intronic
1161914103 19:7216030-7216052 AGATGGAAGCAGGCTGGGCACGG + Intronic
1161997082 19:7719822-7719844 AGATGGCAGGTGGCGAGGAGAGG + Intergenic
1162141881 19:8590010-8590032 AGATGGAGGGAGGCCAGGCTTGG + Intronic
1162501097 19:11054361-11054383 AGGAGGCAGGAGGCCAGGCCAGG + Intronic
1162545879 19:11329316-11329338 AATTGGAATCAGGCCAGGCGTGG + Intronic
1162644872 19:12041497-12041519 AGATGGGTGTGGGCCAGGCGCGG + Intronic
1162724765 19:12683396-12683418 AAATAGCAGCAGGCCAGGCGCGG - Intergenic
1162738763 19:12761822-12761844 AGAAAGCAGAAGGCCGGGCGTGG - Intergenic
1162739379 19:12765455-12765477 AAAAGAAAGCAGGCCAGGCGCGG + Intronic
1162842613 19:13367435-13367457 AGAAGGCAGGGGGCCAGGTGTGG + Intronic
1163219774 19:15910259-15910281 AGACTGCAACAGGCCGGGCGCGG + Intergenic
1163245723 19:16092824-16092846 AGAAGTAAGCAGGCCAGGCACGG - Intronic
1163387327 19:17007875-17007897 AGCTGGGAGCAGGCCGGGCGTGG + Intronic
1163400003 19:17086334-17086356 TGAGGACAGCAGCCCAGGCGAGG - Intronic
1163445699 19:17345160-17345182 AGAAGCCATCAGGCCAGGCACGG - Intergenic
1163569850 19:18074759-18074781 AAATAGCAGTAGGCCGGGCGCGG + Intronic
1163721943 19:18902372-18902394 AGACTGCAGATGGCCAGGCGTGG + Intronic
1163736148 19:18982159-18982181 AGAAAGCAGCTGGCCAGGCGTGG + Intergenic
1163945161 19:20529687-20529709 ACAGGGCAGCTGGCCAGGCGGGG + Intergenic
1164168103 19:22700489-22700511 ACGGGGCAGCTGGCCAGGCGGGG + Intergenic
1164224136 19:23227262-23227284 ATTTAGAAGCAGGCCAGGCGTGG + Intronic
1164657497 19:29934224-29934246 AGATGGAATAAGGCCAGGCATGG - Intronic
1165393940 19:35553821-35553843 AGATGGGAACTGGCCAGGAGTGG + Exonic
1165400307 19:35595442-35595464 AAATAGAAGTAGGCCAGGCGCGG + Intergenic
1165433943 19:35786828-35786850 CTAGGGCAGCAGGCGAGGCGGGG - Intronic
1165490505 19:36120581-36120603 AGAAGGCTGCAGTACAGGCGAGG + Intronic
1165492008 19:36129137-36129159 AGAATGCTGCAGGCCAGGCAGGG + Intergenic
1165738655 19:38193049-38193071 AGGAGGCAGAAGGCCAGGGGTGG + Intronic
1165857904 19:38890985-38891007 AGATGCCATCAGGCCAGGCCTGG + Intronic
1165922569 19:39307984-39308006 GGATGGCAGCAGGCACAGCGAGG + Exonic
1166024385 19:40067649-40067671 GGATGACAGAAGGCCAGGCTTGG + Intergenic
1166216719 19:41340569-41340591 AAGTGGCAGCAGGCTGGGCGCGG - Intronic
1166305164 19:41933123-41933145 AGGTGGCAGCCGGCCCGGGGAGG + Intergenic
1166519793 19:43472721-43472743 AGAAGGGAACAGGCCAGGCACGG + Intergenic
1166729619 19:45051676-45051698 AGCTTGCTGCAGGCCGGGCGCGG + Intronic
1166763789 19:45240603-45240625 AAATGGCTTAAGGCCAGGCGTGG + Intronic
1167015593 19:46838994-46839016 AGATGGCAAAAGGTCAGGCGCGG + Intronic
1167261416 19:48461028-48461050 AGAAGGTGGCTGGCCAGGCGCGG + Intronic
1167280862 19:48567677-48567699 AGAAGGCAACAGACCAGGTGCGG + Intronic
1167378346 19:49124347-49124369 ATATAGCAGGGGGCCAGGCGCGG - Intronic
1167495365 19:49815060-49815082 AGGCTTCAGCAGGCCAGGCGCGG + Intronic
1167552167 19:50168791-50168813 AGGAGGCTGTAGGCCAGGCGTGG - Intergenic
1167975514 19:53223032-53223054 ACAGGGCGGCTGGCCAGGCGGGG - Intergenic
1168031597 19:53684081-53684103 AGCTGTCTGCAGGCCAGGCACGG + Intergenic
1168068636 19:53935929-53935951 AGATAGCATTAGGCCAGGCGTGG - Intronic
1168082242 19:54018728-54018750 AGCTAGAAGGAGGCCAGGCGCGG + Intergenic
1168087238 19:54057149-54057171 AGATAGATGCAGGCCAGGCACGG - Intronic
1168645116 19:58054494-58054516 AGCTGGCAGGAGGGCAGCCGGGG - Exonic
924972909 2:146242-146264 AGAAGCAACCAGGCCAGGCGTGG - Intergenic
925184156 2:1835862-1835884 AAATGTCAGCATGCCAGGGGCGG - Intronic
925318732 2:2944935-2944957 AGATAGAATCAGGCCAGGTGTGG + Intergenic
925716176 2:6786259-6786281 AGATGGCAGCAGCCCAGCCAGGG + Intergenic
926371862 2:12186663-12186685 AGCTGGTAGCAGGCCAAGCCAGG + Intergenic
926607927 2:14915898-14915920 AGATGGCAGTAGGCAAAGAGAGG - Intergenic
926847364 2:17156795-17156817 AAAATACAGCAGGCCAGGCGCGG + Intergenic
927076289 2:19581118-19581140 ACATGGCAGCTGGCCAGGCGTGG + Intergenic
927141388 2:20133377-20133399 GGGTGGCAGCAGGCAAGGAGGGG - Intergenic
927176450 2:20412152-20412174 GGATGGAAGGAGGCCAGGTGCGG - Intergenic
927353796 2:22150974-22150996 AAATTGGAACAGGCCAGGCGAGG - Intergenic
927744059 2:25599802-25599824 AGCTGGCTGCTGGTCAGGCGTGG + Intronic
927774832 2:25894550-25894572 AGAATGCAGGAGGCCAGGCGTGG - Intergenic
928142151 2:28739152-28739174 AGAAGGCTCCAGACCAGGCGTGG - Intergenic
928325220 2:30314181-30314203 AAATGAAAACAGGCCAGGCGCGG - Intronic
928340032 2:30435080-30435102 AGATGGCAACAAGGCAGCCGGGG + Intergenic
928928172 2:36598951-36598973 AAATTGGAGTAGGCCAGGCGAGG + Intronic
929739910 2:44589147-44589169 ATAGGGCGGCTGGCCAGGCGGGG - Intronic
931305768 2:61026634-61026656 AGGTGGCCACAGGCCAGGCGTGG - Intronic
931323717 2:61196982-61197004 AGATGGAAATAGGCCAGGCGTGG + Intronic
931539753 2:63317187-63317209 ATATGGAACCAGGCCAGGCATGG + Intronic
931709137 2:64972687-64972709 TGATGGCAGCAGGCCCTGAGAGG + Intergenic
932437897 2:71713654-71713676 AGAAGGAAGCATGCCTGGCGGGG + Intergenic
932762084 2:74444711-74444733 AGGTGCCAGCTGGCCAGGCTTGG + Intergenic
932885089 2:75542117-75542139 GGATGGCAGCAGGCAAAGAGAGG - Intronic
932913396 2:75829277-75829299 AGGTGTCAGCAGGCCGGGCGCGG + Intergenic
933466443 2:82658097-82658119 AGAAGCCAGCAGGCCATCCGTGG + Intergenic
933670573 2:85003725-85003747 AAATGACAGTAGGCCAGGTGTGG - Intronic
933730765 2:85454700-85454722 AGCAGGAAGGAGGCCAGGCGTGG + Intergenic
933736772 2:85501772-85501794 AGATGTTTGCCGGCCAGGCGTGG + Intergenic
933833039 2:86225788-86225810 AGCAGGCTGCAGGCCAGGCACGG + Intronic
934040870 2:88126537-88126559 AGATAGCAGCAGGCCAGGCCAGG - Intronic
934685825 2:96321218-96321240 AGTTGGCAGGAGGCGAGACGAGG + Intergenic
935202694 2:100871619-100871641 AGAAGTAGGCAGGCCAGGCGTGG - Intronic
935268541 2:101414563-101414585 AGATGCCCGATGGCCAGGCGTGG - Intronic
935566636 2:104615644-104615666 AAATAGCAGCTGGCCAGGCATGG - Intergenic
935725523 2:106020805-106020827 ATATTGCAGCAGCCCAGGCAGGG + Intergenic
935969955 2:108521405-108521427 AAATGGCATCAGGCTGGGCGTGG + Intergenic
936004926 2:108877175-108877197 AAAATGCAGAAGGCCAGGCGCGG + Intronic
936133615 2:109869627-109869649 AAATGGCATCAGGCTGGGCGTGG + Intergenic
936211082 2:110501858-110501880 AAATGGCATCAGGCTGGGCGTGG - Intergenic
936420213 2:112356424-112356446 AAATGGCATCAGGCTGGGCGTGG - Intergenic
936475065 2:112832617-112832639 AGCTGCCAGGAGGCCAGGCAGGG + Intronic
936504277 2:113092667-113092689 AGATGGCTCTAGGTCAGGCGTGG + Intergenic
936978885 2:118245709-118245731 AGATAAAAACAGGCCAGGCGTGG + Intergenic
937055575 2:118932971-118932993 AGATTTCAGCAAGCCAGGCATGG - Intergenic
937243107 2:120475140-120475162 AAAGGGCTGCTGGCCAGGCGCGG - Intergenic
937339515 2:121082241-121082263 AGATGGCAGCAGGTTTGGTGAGG + Intergenic
937903938 2:127042790-127042812 GGAAGGAAGCTGGCCAGGCGCGG - Intergenic
937985218 2:127635295-127635317 AGAAGCCAGCAGGCCAGGGCAGG + Intronic
938389620 2:130894498-130894520 AAATGGGAGCAGTGCAGGCGAGG + Intronic
938937423 2:136139273-136139295 TGAAGGCAGCAAGCCAGGAGTGG - Intergenic
940182111 2:150946194-150946216 AGATGGCAGAAGACCAAGTGAGG + Intergenic
940299233 2:152160711-152160733 ATGGGGCAGCTGGCCAGGCGGGG - Intronic
940933088 2:159458613-159458635 AGAAAGGACCAGGCCAGGCGCGG - Intronic
940961799 2:159794932-159794954 AGGTGGCATCAGGCCGGGCACGG + Intronic
941070761 2:160951914-160951936 AGAAGGAAGTAAGCCAGGCGAGG - Intergenic
941633350 2:167908427-167908449 AGACAGCAACAGGCCAGGCATGG + Intergenic
941718219 2:168786190-168786212 AGACATCAGCAGGCCAGGAGAGG + Intergenic
941814122 2:169783510-169783532 ATTAGGCAGGAGGCCAGGCGTGG + Intergenic
942096377 2:172538451-172538473 ACAGGGCAGCTGGCCAGGCGGGG - Intergenic
942939471 2:181599243-181599265 ACTTGGAAGCAGGCCAGGCATGG + Intronic
943120187 2:183725606-183725628 AGAAGCAAGCAGGCCAGGCATGG + Intergenic
943603559 2:189949918-189949940 AGTAGGTAACAGGCCAGGCGTGG - Intronic
943723243 2:191227459-191227481 AGAGAGAAACAGGCCAGGCGTGG + Intergenic
944131017 2:196347500-196347522 AGATTTCACCAGGCCAGGTGTGG - Intronic
944759583 2:202800169-202800191 ATAAAGCAGCAGGCCAGGCGCGG - Intronic
945146019 2:206739123-206739145 AGTGGGAAGCAGGCCAGGCACGG + Intronic
945360593 2:208891598-208891620 ACATGGTAGCAGGCAAGACGAGG - Intergenic
945601864 2:211877815-211877837 ACAATGCATCAGGCCAGGCGAGG + Intronic
945702637 2:213190684-213190706 ATATGGCTTAAGGCCAGGCGCGG - Intergenic
946294598 2:218773814-218773836 AGAAAGCAGAGGGCCAGGCGTGG - Intergenic
946919235 2:224560709-224560731 TGATGATAGCAGGCCAGGAGTGG - Intronic
946931995 2:224679960-224679982 ATAAGGCTGTAGGCCAGGCGTGG + Intergenic
947135416 2:226972531-226972553 AGATGGCACCAGGGCAGACGTGG + Intronic
947510110 2:230744580-230744602 ATATGGTTGGAGGCCAGGCGTGG - Intronic
947710695 2:232313843-232313865 GGATGGCAGCAGGCCAAGAGAGG + Intronic
947865250 2:233393316-233393338 AAAAGGAAACAGGCCAGGCGTGG - Intronic
948025717 2:234774737-234774759 AAATGAAAGAAGGCCAGGCGCGG + Intergenic
948272579 2:236686089-236686111 AGAGGGCAGGAGGCCAGGGCTGG - Intergenic
948499943 2:238384671-238384693 AAAGGACATCAGGCCAGGCGTGG - Intronic
948826361 2:240575159-240575181 AGATGGCAGCAGGGCCGTCCCGG - Intronic
1169108736 20:3019005-3019027 ACAGGGCAGCTGGCCGGGCGGGG + Intronic
1169161175 20:3379768-3379790 AGATAAAAACAGGCCAGGCGTGG + Intronic
1169192259 20:3665860-3665882 AGTTTGCAGTAGGCCAGGCGCGG - Intergenic
1170304757 20:14926118-14926140 AGATGGCAACAGGACAGCCTGGG - Intronic
1170320757 20:15095363-15095385 AGACCACAGCAGGCCGGGCGTGG - Intronic
1170919500 20:20663880-20663902 TAATGGCTCCAGGCCAGGCGTGG - Intronic
1171951773 20:31427427-31427449 ACAGGGCGGCTGGCCAGGCGGGG - Intergenic
1171972166 20:31571176-31571198 AAATGGCACCAGGCCGGGCAAGG + Exonic
1172209168 20:33185302-33185324 ACAGGGCAGCTGGCCTGGCGGGG + Intergenic
1172725669 20:37038891-37038913 AAATGACTGCAGGCCAGGTGCGG - Intronic
1172754615 20:37274400-37274422 AACTTGCAGGAGGCCAGGCGCGG + Intergenic
1172837808 20:37884234-37884256 AAATGATAGGAGGCCAGGCGTGG + Intergenic
1172969881 20:38865579-38865601 AGAATGCAGCAGGCCGGGCGCGG - Intronic
1173019369 20:39254220-39254242 AGAAGGAATCAGGCCAGGTGTGG - Intergenic
1173460553 20:43239869-43239891 GGATGGCAGCAGGCAAAGAGGGG + Intergenic
1173574928 20:44106688-44106710 AGATGGCAGCAGGCAAAGAGAGG + Intergenic
1173649864 20:44656313-44656335 AAACGGCAGGAGGCCAGGCACGG - Intergenic
1173769548 20:45645879-45645901 ACGGGGCAGCTGGCCAGGCGGGG + Intergenic
1174241728 20:49141602-49141624 ACAAGGCAACGGGCCAGGCGAGG + Intronic
1174340949 20:49894816-49894838 AGATTGCTTCAGGCCAGGCGCGG - Intergenic
1174344971 20:49922509-49922531 ACGGGGCAGCTGGCCAGGCGGGG - Intergenic
1174795940 20:53522636-53522658 AGAAGGAAAGAGGCCAGGCGCGG - Intergenic
1174920253 20:54694482-54694504 GGATGGCAGCAGGCAAAGAGAGG + Intergenic
1175085081 20:56451620-56451642 AGATGGTGGCAGACCAGGTGGGG + Intronic
1175108610 20:56630751-56630773 AGGTGGCAGCGCGGCAGGCGCGG - Intronic
1175256817 20:57652711-57652733 AGAGGGCAGCAGGGCTGGCGGGG + Intronic
1176051946 20:63124614-63124636 ACATGGCAGCAGGGCAGACATGG + Intergenic
1176146618 20:63568329-63568351 AGGTGGGGGCAGGCCAGGCTCGG + Intronic
1176152676 20:63600425-63600447 AGACTGCAGCAGGCCGGGCGCGG + Intronic
1176173141 20:63705342-63705364 AGATGGCATCAGGGCAGCCAAGG + Intronic
1176174035 20:63709345-63709367 GCATGGAAGGAGGCCAGGCGCGG + Intronic
1176175550 20:63721723-63721745 AAATGCCTTCAGGCCAGGCGCGG + Intronic
1176295366 21:5069396-5069418 GGAAGGCAGGCGGCCAGGCGTGG - Intergenic
1176511389 21:7751170-7751192 GAATGGCCGCAGGCCGGGCGTGG + Intronic
1176869938 21:14076216-14076238 AGGTGGCAGCTGGCCGGGCTTGG - Intergenic
1177547011 21:22571913-22571935 AAATGACTGCAGGCCAGGCACGG + Intergenic
1177730576 21:25023448-25023470 AGATGCCAACAGGGCAGGAGAGG - Intergenic
1177786553 21:25677960-25677982 AAATAGGAGTAGGCCAGGCGCGG + Intronic
1178121270 21:29472841-29472863 ATACTGCAGCAGGCCAGGCGCGG - Intronic
1178641484 21:34348167-34348189 CAGTGGCAGAAGGCCAGGCGCGG + Intergenic
1178645503 21:34381699-34381721 GAATGGCCGCAGGCCGGGCGTGG + Intronic
1178824217 21:36001975-36001997 AGAAGGCAGTGGGCCAGGGGTGG - Intronic
1178926211 21:36777406-36777428 AACTGGCAGCAGGCCAGACTCGG + Intronic
1179678381 21:43000418-43000440 GGATGGCAGCAGGCAAAGAGAGG + Intronic
1179805319 21:43833566-43833588 ATCTGGCATCTGGCCAGGCGTGG - Intergenic
1179861683 21:44192728-44192750 GGAAGGCAGGCGGCCAGGCGTGG + Intergenic
1179952469 21:44716940-44716962 AAAGGGAAGCAGGCCAGGCGTGG - Intergenic
1180605617 22:17056992-17057014 GGGTGGCAGCAGGCCAGGGCTGG - Intergenic
1180925816 22:19554119-19554141 GGCTTGCAGCAGGCCAGGCATGG - Intergenic
1180980435 22:19875786-19875808 GGATGGCTGCAGGCCAGGTTTGG - Exonic
1181031836 22:20152083-20152105 AGAGGATAACAGGCCAGGCGCGG - Intergenic
1181168660 22:20996280-20996302 AGTTGGCAGCTGGCAAGGAGGGG + Intronic
1181305527 22:21915156-21915178 AAATGGAAGAAAGCCAGGCGTGG + Intergenic
1181438013 22:22921556-22921578 AGAGGGCAGGAGCCCAGGCAAGG - Intergenic
1181511739 22:23392488-23392510 AGAGGGCAGCAGGTCGGGCCAGG + Intergenic
1182107568 22:27700211-27700233 AGATGTCATTAGGCCAGGCATGG + Intergenic
1182488423 22:30653662-30653684 AGAAGGGAGGCGGCCAGGCGTGG - Intronic
1182575601 22:31270925-31270947 AGATGGCAGCAGGGAAGCAGAGG + Intronic
1182686748 22:32126662-32126684 AGAGGGAAGTAGGCCAGGTGCGG + Intergenic
1182792655 22:32965982-32966004 AGATGGAATCTGGCCGGGCGCGG - Intronic
1182836548 22:33346591-33346613 AGAAGGTAGGAGGCCAGGCGCGG - Intronic
1183086605 22:35490828-35490850 AGATCATTGCAGGCCAGGCGTGG + Intergenic
1183205597 22:36416839-36416861 AGAGAGCATCTGGCCAGGCGAGG - Intergenic
1183206060 22:36419780-36419802 AGAGACCAGCAGGCCAGGTGCGG + Intergenic
1183229219 22:36570467-36570489 AGAAGGCAACAGGCCGGGCGCGG + Intronic
1183272118 22:36868688-36868710 AGAAGGCAGGAGGCGAGGCTGGG + Intronic
1183841424 22:40502006-40502028 ACGGGGCAGCTGGCCAGGCGGGG + Intronic
1184119899 22:42443170-42443192 GGATGGGAGCAGGGAAGGCGGGG + Intergenic
1184374066 22:44100523-44100545 AGATGGCTCCTGGCCAGGAGTGG - Intronic
1184450065 22:44577442-44577464 GGATGCCAGCAGGGCAGGAGTGG + Intergenic
1185019449 22:48365620-48365642 AGGAGGCAGCAGGGCAGGCACGG + Intergenic
1185233782 22:49699578-49699600 ACATGCCAGCAGCCCAGGCCAGG + Intergenic
1185312357 22:50163095-50163117 GGGTGGCAGGAGACCAGGCGGGG + Intergenic
949980495 3:9499492-9499514 AGATGGCAGCTGGCCAGGTGCGG + Exonic
950812567 3:15663282-15663304 AGAAGACTGTAGGCCAGGCGCGG - Intergenic
950947090 3:16960331-16960353 AACAGGCAGAAGGCCAGGCGAGG - Intronic
951016634 3:17739696-17739718 AAATGAAAGCAGGCCAGGCGCGG + Intronic
951092947 3:18597098-18597120 GGATGGCAGCAGGCAAAGAGAGG + Intergenic
951231033 3:20180004-20180026 GAGTGGCTGCAGGCCAGGCGTGG + Intronic
951627544 3:24682464-24682486 ACATGAAAGGAGGCCAGGCGCGG + Intergenic
951711188 3:25585998-25586020 AACTGGGGGCAGGCCAGGCGGGG + Intronic
951865000 3:27298341-27298363 GGATGGCAGCAGGCAAAGAGAGG - Intronic
951888053 3:27543225-27543247 AGATGATTCCAGGCCAGGCGCGG - Intergenic
952315179 3:32226184-32226206 GGATGGCAGCAGGTCAAGAGAGG + Intergenic
952943425 3:38459912-38459934 AGCTTGAAGCAGGCCAGGGGAGG - Intronic
953318488 3:41950531-41950553 AGCTGGGAGTGGGCCAGGCGCGG - Intronic
953409752 3:42684091-42684113 AGATGACAGCAGGCTGGGCTAGG - Intergenic
953547203 3:43872375-43872397 AGGGGGCAGCAGCCCAGGTGGGG - Intergenic
953779230 3:45851513-45851535 AGATCACAGCTGGCCAGGCACGG - Intronic
953842071 3:46397088-46397110 GGATGGGAGCCGGCCAGGTGAGG - Intergenic
954079240 3:48203322-48203344 AAAAGGCAGGAGGCCAGGTGCGG + Intergenic
954207083 3:49067688-49067710 ATCTGGCAAAAGGCCAGGCGCGG + Intronic
954295880 3:49674287-49674309 AGATTGCCGCAGGGCAGGGGCGG + Exonic
954395489 3:50291298-50291320 AAATGGGAGCAGGCTGGGCGTGG - Intronic
954650669 3:52160382-52160404 AGATGGATGCCAGCCAGGCGTGG - Intergenic
954723425 3:52585813-52585835 ATGTGGAAGAAGGCCAGGCGCGG - Intronic
955235481 3:57135305-57135327 AGGAGGCAGAAGGCCAGGCCAGG + Intronic
955299268 3:57761755-57761777 AGTTGGAAGAAGGCCGGGCGCGG + Intronic
955608600 3:60732974-60732996 ATATGCAATCAGGCCAGGCGTGG - Intronic
955808588 3:62762364-62762386 ATATGGGAGAAGGCCAGGTGTGG + Intronic
956221065 3:66903763-66903785 GGATGGCAGCAGGCAAAGAGAGG + Intergenic
956487567 3:69739302-69739324 AGCTCCCAGAAGGCCAGGCGGGG - Intergenic
956651655 3:71509886-71509908 AGAAGGAATCAGGCCAGGCACGG + Intronic
956691018 3:71877637-71877659 TGATGCCTGCAGGCCAGGTGGGG - Intergenic
956691426 3:71881267-71881289 ACAGGGCAGCATGCCAGGAGGGG - Intergenic
957090123 3:75721569-75721591 AAATAACATCAGGCCAGGCGTGG - Intronic
957686323 3:83507015-83507037 AGAAAGCATAAGGCCAGGCGCGG + Intergenic
957861611 3:85959257-85959279 AGATGGAAGCATGCCAGGAGAGG - Intronic
958701353 3:97595351-97595373 AAATCACAGAAGGCCAGGCGCGG + Intronic
959319233 3:104849190-104849212 GGATGGCAGCAGGCAAAGAGAGG - Intergenic
959381179 3:105642684-105642706 AGATGGCAGCAGGCAAAGAGAGG + Intergenic
959773062 3:110123042-110123064 AAATGATAGCAGGCCAGGCACGG - Intergenic
959932478 3:111999285-111999307 AGAGGGCAGAAAGCCGGGCGTGG - Exonic
960285728 3:115826394-115826416 AGACAGAAACAGGCCAGGCGTGG - Intronic
960924372 3:122780628-122780650 ACAGGGCGGCTGGCCAGGCGGGG + Intronic
961075711 3:123979943-123979965 AGATGGCAGCAGTGCAGCCGGGG - Intronic
961120698 3:124368115-124368137 ACGGGGCAGCTGGCCAGGCGGGG + Intronic
961163751 3:124750235-124750257 ATGGGGCAGCTGGCCAGGCGGGG + Intergenic
961307974 3:125972571-125972593 AGATGGCAGCAGTGCAGCCGGGG + Intronic
961369919 3:126422898-126422920 AGATGGGACCTGGCCAGGCAGGG + Intronic
961662807 3:128479232-128479254 AGATGGGAGCAGTTCAGGGGAGG + Intergenic
961674857 3:128558473-128558495 AGACGGCAGCAGCCATGGCGAGG - Intergenic
961962487 3:130868260-130868282 ACAGGGCAGCTGGCCGGGCGGGG - Intronic
962112800 3:132470817-132470839 ACAGGGCGGCTGGCCAGGCGGGG + Intronic
962405660 3:135097748-135097770 AGCTGGCAGCAGGCCCAGGGAGG + Intronic
962506063 3:136047609-136047631 AGATGAGAACAGGCCGGGCGTGG + Intronic
964365296 3:155944296-155944318 AGATAACAGAAGGCCAGGCAAGG - Intergenic
964411039 3:156398300-156398322 AGATGATAGGGGGCCAGGCGCGG + Intronic
964467861 3:157017646-157017668 AGAAAGCTGGAGGCCAGGCGCGG + Intronic
965392378 3:168120404-168120426 AGTGAGCAGCCGGCCAGGCGCGG - Intergenic
965638230 3:170806306-170806328 ACTTGGCAATAGGCCAGGCGCGG - Intronic
965733683 3:171799048-171799070 AGAGGGACTCAGGCCAGGCGCGG + Intronic
965825807 3:172728316-172728338 AAAAGGAAGCAGGCCAGGTGCGG - Intergenic
965838957 3:172881473-172881495 GGATGGCAGCAGGCAAAGAGAGG - Intergenic
966345473 3:178974369-178974391 GGATGGCAGCAGGCAAAGAGGGG - Intergenic
966358674 3:179109945-179109967 AGATAGAAGTTGGCCAGGCGTGG - Intergenic
966424466 3:179766266-179766288 AGATGGGATCTGGCCAGGCATGG - Intronic
966608364 3:181844264-181844286 AAAAGGCAGCAGGCTAGGCAGGG + Intergenic
966949252 3:184801310-184801332 AGCTGGCTGCAGGGCAGGCAAGG - Intergenic
967313321 3:188127142-188127164 AGATAGCAGCCTGCCAGGTGGGG - Intergenic
967505379 3:190247121-190247143 AATTGGCAGCAGGCAAGGAGGGG + Intergenic
967588901 3:191248654-191248676 AAATTGAAGCAGGCCAGGCATGG + Intronic
967827654 3:193891294-193891316 AAATTGAAGCAGGCCGGGCGCGG + Intergenic
967938902 3:194750983-194751005 AAAGGGAAGGAGGCCAGGCGCGG + Intergenic
968576998 4:1371644-1371666 GGATGGCAGCAGGCAGGGAGAGG + Intronic
968645024 4:1736131-1736153 AGAGGTCGGCAGGCCAGGCGCGG + Intronic
968847215 4:3051353-3051375 AACTGGCAAAAGGCCAGGCGCGG - Intergenic
969031852 4:4221904-4221926 AGTAAGCACCAGGCCAGGCGTGG - Intronic
969381427 4:6801396-6801418 AGATGCCACTAGGCCAGGCATGG + Intronic
969426323 4:7126460-7126482 AGGTGGCAGCAAGGCCGGCGAGG - Intergenic
969579395 4:8055351-8055373 AGGGGGCAGCAGGTCAGGCTGGG - Intronic
970315813 4:14827404-14827426 AGAAGAGAGCAAGCCAGGCGTGG + Intergenic
970536387 4:17034077-17034099 AGATGGCAGGAGACAAGGGGAGG + Intergenic
970619360 4:17801418-17801440 AAATTGAAGCAGGCCAGGCATGG - Exonic
970878138 4:20896508-20896530 AGAGGGAAGCAGGCCATGTGAGG + Intronic
970974370 4:22025905-22025927 AGCTGGCAGCAGGATAGGAGAGG - Intergenic
971325326 4:25638730-25638752 AGGGGGAAGCAGGCCAGGTGCGG + Intergenic
972301101 4:37786465-37786487 GGATGGCAGCAGGCAAAGAGAGG - Intergenic
972305558 4:37826744-37826766 AGAAGGCAGCGGTCTAGGCGAGG + Exonic
972314879 4:37917059-37917081 ACATAGCAGCAGGCCAGGCATGG - Intronic
972369797 4:38412316-38412338 AGCTGGCAGGAGCCCAGGCCTGG + Intergenic
974028507 4:56755300-56755322 AGCTGGCAGGAGACCGGGCGCGG + Intergenic
974476094 4:62382445-62382467 GGATGGCAGCAGGCAAAGAGAGG + Intergenic
974864755 4:67566236-67566258 AGAGGGAAGAGGGCCAGGCGCGG - Intronic
976231398 4:82847003-82847025 TGAAGTAAGCAGGCCAGGCGCGG - Intronic
976260016 4:83136549-83136571 GGATGGCAGCAGGCAAAGGGAGG + Intronic
976427442 4:84921943-84921965 AAATGAAAGCAGGCCAGGTGCGG - Intronic
976868142 4:89756066-89756088 AAATGAAAACAGGCCAGGCGCGG - Intronic
977255688 4:94737510-94737532 TTATGGCAGGAGGCCGGGCGCGG + Intergenic
977821096 4:101473141-101473163 GGATGGCAGCAGGCAAAGAGAGG - Intronic
978037652 4:104015448-104015470 AGAGTGGAGTAGGCCAGGCGCGG - Intergenic
978375211 4:108067975-108067997 AGAAGGCACCGGGCCGGGCGTGG + Intronic
978490605 4:109307480-109307502 AGATGGCCACAGGCTGGGCGTGG - Intergenic
978603332 4:110451035-110451057 AGTGGTGAGCAGGCCAGGCGTGG - Intronic
978774853 4:112495604-112495626 AGATGGCTGCAGGGAAGGCAGGG - Intergenic
979045421 4:115856834-115856856 ATATGGAACCAGGCCAGGCGTGG + Intergenic
980112861 4:128651215-128651237 AAATGTCATGAGGCCAGGCGCGG + Intergenic
980201174 4:129657951-129657973 AGATGGCAGCAGGCAAAGAGAGG + Intergenic
980468678 4:133220746-133220768 AAATGACAGAAGGCCGGGCGCGG - Intergenic
981053270 4:140332665-140332687 AGATGACTCCAGGCCGGGCGCGG - Intronic
981640122 4:146932764-146932786 ATATGAAAGTAGGCCAGGCGCGG + Intronic
982223584 4:153145453-153145475 TGATGACTGCAGGCCAGGTGCGG + Intergenic
982252298 4:153419629-153419651 AGAAGGCAGGAAGCCAGGCATGG + Intergenic
983547837 4:168981107-168981129 AGAAAGAACCAGGCCAGGCGTGG + Intronic
984250059 4:177320755-177320777 AAATGACAGCAGGCCCGGCGCGG - Intronic
984481418 4:180307669-180307691 AGATGTAAGCAGGCAAGGGGAGG - Intergenic
985499886 5:236312-236334 AGAGGGAAGTAGGCCAGGCGTGG - Intronic
985620436 5:952181-952203 AGCTGGCGGCAGGACAGGAGAGG + Intergenic
985737500 5:1593380-1593402 AGAGGGAAGTAGGCCCGGCGTGG + Intergenic
985801599 5:2008128-2008150 AGATTGCAGGAGGCCGGGCGAGG + Intergenic
985963571 5:3322213-3322235 AGCTGTGAGCAGGCCAGGAGTGG + Intergenic
986778527 5:11042781-11042803 AGAAGGCAGCAAGCCTGGTGTGG + Intronic
987129045 5:14843464-14843486 AAATGAGAGCTGGCCAGGCGTGG - Intronic
987790719 5:22563812-22563834 GGATGGCAGCAGGCAAAGAGAGG + Intronic
988189706 5:27913310-27913332 AAATGTCGGCAGGCCGGGCGCGG - Intergenic
990180856 5:53158930-53158952 AAATGGAAACAGGCCAGGTGTGG + Intergenic
990380031 5:55213854-55213876 AAGTGACAGAAGGCCAGGCGCGG + Intergenic
990785498 5:59414304-59414326 TGATGGAAGGAGGCCAGGCTTGG - Intronic
990921889 5:60977545-60977567 AGAAGCCACCAGGCCAGGTGTGG + Intronic
991049937 5:62261995-62262017 AGAAGGAAACCGGCCAGGCGCGG + Intergenic
991109316 5:62880398-62880420 AAATCACATCAGGCCAGGCGCGG - Intergenic
991898212 5:71427961-71427983 AGATGGCAGGAGGTCAGACAGGG + Intergenic
991910037 5:71551878-71551900 ACGGGGCAGCTGGCCAGGCGGGG + Intronic
992112844 5:73512452-73512474 AACTGGCTGCAGGCCAGGCACGG - Intergenic
992215712 5:74523042-74523064 GGATGGCAGCAGGCAAAGAGAGG - Intergenic
992443178 5:76812880-76812902 ACGTGGCGGCTGGCCAGGCGGGG - Intergenic
992744607 5:79806795-79806817 AAATGGCAAAAGGCCAGGCCAGG - Intergenic
992745493 5:79816233-79816255 TGATGGCAGTAGGCAAGGGGTGG + Intergenic
993087332 5:83379365-83379387 AGATTCAAGGAGGCCAGGCGTGG + Intergenic
993662786 5:90659740-90659762 AGATAGAAACAGGCCGGGCGCGG + Intronic
993913217 5:93709342-93709364 AAATTGCAGAGGGCCAGGCGCGG + Intronic
994544148 5:101141331-101141353 AGAAGGCAGGAGGCCAGGTGAGG - Intergenic
994665491 5:102699650-102699672 AAATTGCTGCAGGCCAGACGCGG + Intergenic
996107381 5:119520243-119520265 AGATGGCAGCTGGGCAGGGCTGG + Intronic
996370466 5:122747483-122747505 GGATGGCAGCAGGCAAAGAGAGG + Intergenic
996715468 5:126584369-126584391 GGATGGCAGGAGGCTGGGCGTGG + Intronic
996739261 5:126784317-126784339 AAATGACAGCCGGCCAGGTGCGG - Intronic
997390005 5:133506919-133506941 AGCAGGCAATAGGCCAGGCGCGG + Intronic
997652171 5:135530576-135530598 AGATGGCAGCAGGCAAAGAGAGG + Intergenic
998002051 5:138633116-138633138 GGATGTGAGCAGGCCGGGCGTGG - Intronic
998014105 5:138718617-138718639 ATATGGCTTCAGGCCAGGCATGG - Intronic
998232130 5:140367493-140367515 AGACAGCAGCAGGGCAGGCAGGG - Exonic
998429073 5:142054895-142054917 AGAGGGCACCAGGCTGGGCGTGG + Intergenic
999164207 5:149534189-149534211 AGAAGGCTTCTGGCCAGGCGCGG + Intronic
999371819 5:151060275-151060297 AGAGGGCAGCAGGTCAAGCCCGG + Intronic
1000013997 5:157261615-157261637 AGATGGCCACAGGCCAGGCGTGG + Intergenic
1000076117 5:157788675-157788697 AGATGGAAAGTGGCCAGGCGCGG + Intronic
1000558555 5:162756827-162756849 AGAATACAACAGGCCAGGCGCGG - Intergenic
1000737255 5:164919979-164920001 AGATATGATCAGGCCAGGCGCGG - Intergenic
1000987416 5:167876007-167876029 AGATGGGAGGAGACTAGGCGAGG - Exonic
1001077769 5:168643309-168643331 ACAGGGCAGCTGGCCGGGCGGGG + Intergenic
1001400493 5:171443638-171443660 TGATGATAACAGGCCAGGCGCGG - Intronic
1001507610 5:172292351-172292373 AGAAGGAAACAGGCCAGGCACGG - Intergenic
1001618681 5:173063657-173063679 AGAAATCAGCAGGCCAGGTGTGG - Intronic
1001643286 5:173260795-173260817 TGATGGAAACAGGCCAGGTGTGG + Intergenic
1001643337 5:173261133-173261155 TGATGGAAACAGGCCAGGTGTGG + Intergenic
1001830582 5:174785135-174785157 AAATGAAAGCAGGCCAAGCGTGG - Intergenic
1001847440 5:174934724-174934746 AGATGGCAGGCGGGCAGGTGTGG + Intergenic
1002304825 5:178276970-178276992 AGAGGGCAGCAGCCCAAGCAAGG - Intronic
1002342867 5:178528124-178528146 AGGTGGCAGGAGGCCAGAGGCGG - Intronic
1002472879 5:179447668-179447690 AAATAGCTGCCGGCCAGGCGCGG - Intergenic
1002481343 5:179502994-179503016 AAATAGCTGCCGGCCAGGCGCGG + Intergenic
1002486028 5:179537477-179537499 TGATGGCTGTAGGCGAGGCGCGG - Intergenic
1002984977 6:2180875-2180897 AGATGGATGAAGGCCAGGTGCGG + Intronic
1003438182 6:6113598-6113620 AGAAGGCTGTAGGCCAGGTGTGG - Intergenic
1003617024 6:7664365-7664387 AGATAGCAACAGGCCAGGTGAGG + Intergenic
1003665309 6:8106373-8106395 AGAAGGCACCTGGCCAGGCGCGG + Intergenic
1004322772 6:14645664-14645686 TGATGGCAGGAGGCCAGGCCAGG - Intergenic
1004410081 6:15372995-15373017 AAATGGAAGCAGGCCTGGCATGG - Intronic
1004745244 6:18502695-18502717 AGGCGGCTGCTGGCCAGGCGCGG + Intergenic
1005158984 6:22837097-22837119 ACGGGGCAGCTGGCCAGGCGGGG - Intergenic
1006039640 6:31243866-31243888 ACAGGGCGGCTGGCCAGGCGGGG - Intergenic
1006071915 6:31504547-31504569 AGTTTCCAGAAGGCCAGGCGTGG - Intronic
1006128335 6:31854115-31854137 ACAGGGCGGCTGGCCAGGCGGGG + Intergenic
1006146622 6:31963379-31963401 AGAGGGAAGCAGGTCAGGGGTGG - Intronic
1006319335 6:33311024-33311046 AGAGCACAGCAGGCCGGGCGTGG + Intronic
1006456869 6:34136975-34136997 AGAAGGAAGCAGGCCCTGCGGGG - Intronic
1006475757 6:34252151-34252173 AGATGTTTTCAGGCCAGGCGTGG + Intergenic
1006620092 6:35357825-35357847 AATAGGCAGCAGGCCAGGCATGG - Intronic
1006756153 6:36417462-36417484 AGATAGCAGCAGGCCAGGCATGG + Intronic
1006823386 6:36916112-36916134 AAGTAACAGCAGGCCAGGCGGGG - Intronic
1007452561 6:41951263-41951285 AAGTGGGAGTAGGCCAGGCGCGG + Intronic
1007653823 6:43439870-43439892 ACAGGGTAGTAGGCCAGGCGCGG - Intronic
1008051524 6:46904766-46904788 AGATGGCAGAAGGTCAGTCATGG + Intronic
1008129593 6:47705479-47705501 ACATGGCAGCATGACAGGCAAGG - Intronic
1009794282 6:68447270-68447292 AGACAGCAGCAGGGCAGGAGAGG + Intergenic
1010324205 6:74545882-74545904 AGATGGCAGCAGGCAAAGAAAGG + Intergenic
1010417356 6:75627960-75627982 ATCTGAAAGCAGGCCAGGCGTGG - Intronic
1010809081 6:80278497-80278519 ACATGGAAGCAGACCAGGTGTGG - Intronic
1011545184 6:88475618-88475640 AAATGGCAGGAGGTCAGGCGCGG + Intergenic
1011704271 6:89985441-89985463 AGGTGGCAGCAGTCCAGTGGGGG + Intronic
1012455086 6:99394474-99394496 AGTCGGCTGCAGGCCGGGCGCGG - Intergenic
1012911375 6:105121556-105121578 AGATGAAAGTAGGCCAGGCGCGG - Intronic
1013032664 6:106350113-106350135 AGAAGAAAACAGGCCAGGCGGGG - Intergenic
1013082049 6:106821611-106821633 AGAAGGGGGCAGGCCAGGAGAGG - Intergenic
1013230069 6:108154549-108154571 AGATTCCATCTGGCCAGGCGCGG + Intronic
1013353477 6:109327009-109327031 AGACAGCAGCTGGCCAGGCGCGG - Intergenic
1013558196 6:111278623-111278645 AGATGGCAGCAGGCAAAATGAGG - Intergenic
1014556870 6:122848877-122848899 ACAGGGCGGCTGGCCAGGCGGGG + Intergenic
1014686098 6:124502213-124502235 AGATAGTAGCATGCCAGGAGAGG + Intronic
1014721758 6:124925373-124925395 CAATGGAAGGAGGCCAGGCGCGG - Intergenic
1015569182 6:134604315-134604337 ACCAGGCACCAGGCCAGGCGAGG + Intergenic
1015817373 6:137224555-137224577 AGAGCGCAACAGGCCAGGTGTGG + Intergenic
1015867247 6:137739822-137739844 ACATGCCAGAAGGCCAGGCAGGG + Intergenic
1016000471 6:139036229-139036251 AGAAGGAGGCAGGCCAGGCACGG - Intronic
1016071709 6:139747268-139747290 AGATGCAGGCAGGCCTGGCGTGG + Intergenic
1016595377 6:145791986-145792008 GGATGGCAGCAGGCAAAGAGAGG + Intergenic
1016669922 6:146692339-146692361 AGAAAGCAGCAGGTCAGGAGAGG - Intronic
1016819463 6:148334131-148334153 AGATAATAGCAGGCCGGGCGCGG + Intronic
1016848445 6:148592424-148592446 AAAGAGCACCAGGCCAGGCGTGG - Intergenic
1016968286 6:149739266-149739288 AGAAAACAGTAGGCCAGGCGTGG - Intronic
1017094631 6:150793789-150793811 AAATGAAACCAGGCCAGGCGTGG + Intronic
1017145919 6:151234684-151234706 AGACAGGAGAAGGCCAGGCGCGG - Intergenic
1017215019 6:151899228-151899250 ACTGGGCAGCTGGCCAGGCGGGG + Intronic
1017215115 6:151899452-151899474 ACTGGGCAGCTGGCCAGGCGGGG + Intronic
1017679172 6:156846452-156846474 AGAAGGCCTCTGGCCAGGCGCGG - Intronic
1017731965 6:157324606-157324628 AACTGGTAGTAGGCCAGGCGCGG + Intergenic
1017843931 6:158240672-158240694 ACGGGGCAGCTGGCCAGGCGGGG + Intronic
1018219825 6:161566695-161566717 AAGTGGGAGGAGGCCAGGCGTGG - Intronic
1018623960 6:165759385-165759407 AGGTGGAACCAGTCCAGGCGAGG + Intronic
1019167053 6:170104073-170104095 AGCTAGGCGCAGGCCAGGCGTGG - Intergenic
1019439364 7:1038670-1038692 ACAGGGCGGCTGGCCAGGCGGGG - Intronic
1019439438 7:1038846-1038868 ACAGGGCGGCTGGCCAGGCGGGG - Intronic
1019493990 7:1328433-1328455 AGAAGGAAGGAGGCCAGGTGCGG - Intergenic
1019669192 7:2268562-2268584 ACAGGGCGGCTGGCCAGGCGGGG - Intronic
1019696545 7:2449508-2449530 AGATGTGACCAGGCCAGGCACGG - Intergenic
1019755606 7:2766674-2766696 AGGTGGAAGCTGGCCAGGTGCGG - Intronic
1019771814 7:2888032-2888054 AGGTGGCAGCAGCCCAGCCATGG - Intergenic
1019810673 7:3162974-3162996 GGATGGCAGCAGGCAAAGAGAGG - Intronic
1020006676 7:4787060-4787082 AAATGGCACCAGGCCGGGTGCGG - Intronic
1020326175 7:6976075-6976097 AGATGGCAGCAGCACAGTCCAGG + Intergenic
1020344953 7:7152539-7152561 AGAGGCCAGGTGGCCAGGCGCGG - Intergenic
1020453406 7:8345695-8345717 GGATGGCAGCAGGCAAAGAGAGG - Intergenic
1020453665 7:8347597-8347619 GGATGGCAGCAGGCAAAGAGAGG - Intergenic
1020626872 7:10592113-10592135 AGAAGGTTTCAGGCCAGGCGCGG + Intergenic
1020829434 7:13075475-13075497 AAATAGAAACAGGCCAGGCGCGG - Intergenic
1020888807 7:13853069-13853091 AGAAGGCAGCCGGCCGGGCGCGG + Intergenic
1021181765 7:17514597-17514619 AGAAGGAAGTAGGCCAGGCACGG - Intergenic
1021440071 7:20667778-20667800 AGATGGCAGCAGTACAGTCCAGG - Intronic
1021721472 7:23508782-23508804 AAATGCATGCAGGCCAGGCGTGG - Intronic
1021805324 7:24349333-24349355 AGAGGGCCCCAGGCCAGGAGGGG + Intergenic
1023031405 7:36093205-36093227 AGGTAACAGCAGGCCAGACGGGG + Intergenic
1023985396 7:45091401-45091423 AAAGGTCAGCAAGCCAGGCGTGG + Intergenic
1024011098 7:45267412-45267434 AGATGACAACAGGCAGGGCGTGG + Intergenic
1024091496 7:45946087-45946109 AGAAGGCAACAGGCAAGGTGGGG - Intergenic
1024259403 7:47562678-47562700 AGAAGGCAGCAGACTAGGCCTGG - Intronic
1024948178 7:54833090-54833112 AGTGGGCAGCAGGCCAGACGTGG + Intergenic
1024965510 7:55019593-55019615 ACCGGGCTGCAGGCCAGGCGGGG + Intronic
1025055517 7:55761691-55761713 TCCTGGCATCAGGCCAGGCGTGG + Intergenic
1025900603 7:65741454-65741476 AAATGACAGCTGGCCAGGTGCGG + Intergenic
1025910439 7:65824462-65824484 TCCTGGCATCAGGCCAGGCGTGG - Intergenic
1025981681 7:66412363-66412385 AAAGAGCAGAAGGCCAGGCGTGG - Intronic
1026255629 7:68708850-68708872 ATAAGCAAGCAGGCCAGGCGTGG - Intergenic
1026653658 7:72237490-72237512 AGAGAGCAGCAGACCAGGAGAGG + Intronic
1026807134 7:73435638-73435660 AGATAGCAGCTGGCCGGGCCCGG + Exonic
1026884987 7:73935582-73935604 TGCTGGCAGCAGTCCAGGTGTGG + Intergenic
1026985327 7:74551645-74551667 GTGTGGGAGCAGGCCAGGCGTGG + Intronic
1027236383 7:76300620-76300642 AGATAGAAGATGGCCAGGCGCGG + Intergenic
1027429093 7:78091327-78091349 AGATGGCAGAAGGGCAAGAGAGG - Intronic
1028551542 7:92073204-92073226 AAAAGGAAACAGGCCAGGCGTGG + Intronic
1028759419 7:94478826-94478848 AGATCGCATTAGGCCAGGAGTGG + Intergenic
1029126673 7:98299446-98299468 AGATGGCAGCCTGCCGGGCACGG - Intronic
1029668498 7:102011669-102011691 AAAAGGCAGAAGGCCAGGCGCGG - Intronic
1029708229 7:102286555-102286577 AGCCGGCCCCAGGCCAGGCGCGG - Intronic
1029807427 7:103011342-103011364 AGAAAGAAACAGGCCAGGCGTGG + Intronic
1029925412 7:104311082-104311104 AAATTGCAACAGGCCGGGCGCGG + Intergenic
1029930410 7:104365007-104365029 AGATGGGAGCAGGCTGGGTGTGG + Intronic
1030172124 7:106613486-106613508 AGATCAAAGCAGGCCGGGCGCGG - Intergenic
1030302950 7:107992604-107992626 AGAAGGGAACAGGCCAGGCGCGG + Intronic
1030550065 7:110947008-110947030 AAATGGTATTAGGCCAGGCGCGG - Intronic
1031080752 7:117254891-117254913 GCGTGGTAGCAGGCCAGGCGTGG + Intergenic
1031734728 7:125343621-125343643 AGAAGACAGAAGGCCAGGCGCGG - Intergenic
1032006849 7:128309340-128309362 ACAGGGAAGCAGGCCAGGCGTGG + Exonic
1032130338 7:129222792-129222814 AGAAGGAAGGAGGCCAGGCATGG - Intergenic
1032401448 7:131627120-131627142 AGGTGACAGGAGGCCAGGCGTGG + Intergenic
1033095163 7:138424275-138424297 AGATAGTGTCAGGCCAGGCGCGG + Intergenic
1033214759 7:139485083-139485105 AGAAGGGATGAGGCCAGGCGTGG + Intergenic
1033285412 7:140037030-140037052 AGATGGCAGCAGGCCAGGCGCGG + Intronic
1033360177 7:140633443-140633465 AGAGAGCATTAGGCCAGGCGCGG - Intronic
1033486947 7:141799921-141799943 GGATGGCAGCAGGCAAAGAGAGG - Intergenic
1033520260 7:142153288-142153310 AAATGAAAGCAGGCCGGGCGCGG - Intronic
1034230820 7:149527115-149527137 ATAAAGCTGCAGGCCAGGCGTGG + Intergenic
1035000412 7:155608297-155608319 ACATGACAACTGGCCAGGCGTGG + Intergenic
1035221686 7:157410079-157410101 AGAACACAGCAGCCCAGGCGCGG - Intronic
1036589084 8:10151351-10151373 AGAGAACAGCAGGCCGGGCGTGG + Intronic
1037200850 8:16250466-16250488 GGATGGCAGCAGGCAAAGAGAGG + Intronic
1037663680 8:20949089-20949111 AGATGGCACCAGACCATGCAGGG - Intergenic
1037771462 8:21802643-21802665 TGAAGACAGAAGGCCAGGCGTGG - Intronic
1038274289 8:26107670-26107692 AAAGGGAAGCAGGCCAGGCGAGG + Intergenic
1038336083 8:26646698-26646720 AGATGACATCTGGCCAGGCATGG + Intronic
1038471796 8:27829910-27829932 AGATGACAGGAGGCCAAGAGTGG + Intronic
1038517577 8:28200323-28200345 AGAAAACAACAGGCCAGGCGTGG - Intergenic
1038673794 8:29604481-29604503 AAAGGACAGGAGGCCAGGCGCGG - Intergenic
1038678802 8:29647776-29647798 GGATGGCAGCAGGCAACGAGAGG + Intergenic
1038765308 8:30422558-30422580 AAATAACAGCAGGCCAGGTGAGG - Intronic
1038881546 8:31619051-31619073 GGATGCCAGCGGGCCAGGCCTGG + Intergenic
1039467616 8:37795856-37795878 AGCTGCCTGCAGGCCGGGCGCGG - Intronic
1039499706 8:38006792-38006814 ATATGGATCCAGGCCAGGCGTGG - Intergenic
1039630428 8:39106443-39106465 ACAAGGCAACAGGCCAGGTGAGG - Intergenic
1039906805 8:41792283-41792305 AGAGGGCTGCAGTCCAGGCTGGG + Intronic
1039952108 8:42180590-42180612 AGATGGCAGCCTGCCAGGGGTGG + Exonic
1040855877 8:51947567-51947589 AAATCACAGCAGGCCAGGCATGG - Intergenic
1041267553 8:56080021-56080043 AGCTAGCACCAGGCCAGGTGCGG + Intergenic
1041269749 8:56099790-56099812 AGAGGGCAGCAGCCCAGGCATGG - Intergenic
1041687427 8:60657343-60657365 AGCTGCCCCCAGGCCAGGCGCGG + Intergenic
1042103122 8:65295824-65295846 ACATGGCAGCAGGCAAGACAGGG - Intergenic
1042136456 8:65637461-65637483 AAAAAGCAGCTGGCCAGGCGTGG + Intergenic
1042258002 8:66826259-66826281 AGATGAAGGAAGGCCAGGCGTGG - Intronic
1042327703 8:67545851-67545873 AGATAACAGTAGGCCAGGCGAGG - Intronic
1043649148 8:82566362-82566384 AGAAGACAACAGGCCAGGCACGG - Intergenic
1044087331 8:87956853-87956875 GGATGGCAGCAGGCAAAGAGAGG + Intergenic
1044301637 8:90591207-90591229 ACATGGCTGCAGGTCAGGCAAGG + Intergenic
1044850080 8:96419241-96419263 AGGTGACTGCAGGCCGGGCGCGG - Intergenic
1044895327 8:96885703-96885725 AGATGCCAATAGGCCAGGCGTGG + Intronic
1045011092 8:97958938-97958960 AGAGGGAAGCAGGAGAGGCGTGG - Intronic
1045110553 8:98936206-98936228 ACATGGATGCAGGCCAGGCATGG - Intronic
1045281277 8:100751597-100751619 AAATGGAAACAGGCCAGGCGTGG - Intergenic
1046156298 8:110294228-110294250 AGATTCCAGTAGGCCGGGCGTGG - Intergenic
1046470565 8:114668169-114668191 AGTGGTCAACAGGCCAGGCGTGG - Intergenic
1047366245 8:124214362-124214384 AGATGTGAGAAGGCCAGGCATGG + Intergenic
1047524692 8:125622648-125622670 AGAGTGCAACAGGCCGGGCGTGG - Intergenic
1047607208 8:126487517-126487539 GGATGGCAGCAGGCAAAGAGAGG - Intergenic
1047920602 8:129630745-129630767 GGATGGCAGCAGGCAAAGAGAGG + Intergenic
1047947017 8:129890600-129890622 ACTTGAAAGCAGGCCAGGCGTGG + Intronic
1047977853 8:130149143-130149165 AGTTAGCCTCAGGCCAGGCGCGG - Intronic
1049024426 8:139979064-139979086 GGTTGACAGCAGGCCAGGTGCGG + Intronic
1049133562 8:140872333-140872355 AGCATGCAGCGGGCCAGGCGTGG - Intronic
1049199070 8:141331109-141331131 GGAGGGCAGCAGGGCAGGCTGGG + Intergenic
1049440237 8:142606249-142606271 AGATGGGAGCAGGGCTGGGGTGG + Intergenic
1049503386 8:142980637-142980659 ACCTGGCAGTTGGCCAGGCGTGG - Intergenic
1049550802 8:143258328-143258350 AGATTTCAGGAGGCCAGGCCTGG - Intronic
1049558377 8:143295178-143295200 AGCTGGCAGCAAGCCAGGACGGG - Intronic
1049566558 8:143343049-143343071 ATAAGTTAGCAGGCCAGGCGTGG - Intronic
1049760070 8:144328065-144328087 AAATAACAACAGGCCAGGCGCGG - Intergenic
1049969404 9:808122-808144 ACAAGGGAGCAGGCCAGGAGTGG + Intergenic
1050093456 9:2039550-2039572 AGATGCCACCAAGCCAGCCGGGG + Exonic
1050250848 9:3742839-3742861 ACATGGCAGCAGGCAAGACAGGG - Intergenic
1050415378 9:5411091-5411113 AGATGGAAACAGGCCAGTTGCGG + Intronic
1050454453 9:5820007-5820029 AGAAGGCTACAGGCCGGGCGTGG + Intronic
1050852089 9:10300747-10300769 AAAAGGCAGCAGCCCAGGTGAGG + Intronic
1051385859 9:16507715-16507737 AGAAGGAAATAGGCCAGGCGCGG - Intronic
1052442238 9:28512028-28512050 AGAAGGCAGGATGGCAGGCGTGG + Intronic
1053298916 9:36935089-36935111 GGTTTGCAGCAGGCCAGGCATGG + Intronic
1054707688 9:68479642-68479664 AGGAGGCATCAGGCCGGGCGCGG + Intronic
1054757967 9:68977935-68977957 AGAAGCCAATAGGCCAGGCGCGG - Intronic
1055242210 9:74197937-74197959 AAAGGGCAGCTGGCCGGGCGGGG - Intergenic
1055486050 9:76757669-76757691 AGATTACAACAGGCCAGGCATGG + Intronic
1055731064 9:79279682-79279704 AGTTGGCAGAAGGCTAGGGGAGG + Intergenic
1056153605 9:83813807-83813829 AGATGGCAGCAGGCCACACATGG + Intronic
1056356885 9:85809294-85809316 AGATGGCAGCAGGCCAGACATGG - Intergenic
1056364893 9:85894520-85894542 AGATGGGGCCAGGCCAGGCGTGG + Intergenic
1056393964 9:86164604-86164626 AGGTTGCAGTAGGCCAGGTGAGG - Intergenic
1056475899 9:86950627-86950649 GGATGGCAGCAGGCAACGAGAGG + Intergenic
1056602238 9:88055221-88055243 AGATCTCAGCAAGCCAGGCAGGG - Intergenic
1057060952 9:92003695-92003717 AGCTGGCAGCAGGCCACCCTCGG + Intergenic
1057278120 9:93686979-93687001 AGATGGCAGAGGGCAAGGCTTGG + Intergenic
1057419368 9:94898326-94898348 AGAATGAAGCTGGCCAGGCGTGG + Intronic
1057486016 9:95484913-95484935 AGGTGTCAGCGGGCCAGGCATGG + Intronic
1057780042 9:98041971-98041993 AGATGTCCTTAGGCCAGGCGCGG - Intergenic
1058302105 9:103388813-103388835 ATATGCAATCAGGCCAGGCGTGG + Intergenic
1058378936 9:104357726-104357748 GGCTGGCAACAGGCCTGGCGTGG + Intergenic
1059383514 9:113946754-113946776 AAATGGCAGCAGGCAAGTTGGGG + Intronic
1059478937 9:114572894-114572916 AAATGGCATCAGGCCGGGCACGG - Intergenic
1059752546 9:117261773-117261795 AGCTAGCAGCAGGCAAGGAGGGG + Intronic
1059882118 9:118702766-118702788 AGATGGAAACAGGCCAGGTATGG - Intergenic
1060295671 9:122341323-122341345 AGTGGGTAGCAGGCCAGGCGTGG - Intergenic
1060418359 9:123449244-123449266 GGGTGGCAACAGGCCAGACGCGG + Intronic
1060563174 9:124565136-124565158 AGAAGTCAGAAGGCCAGGTGTGG + Intronic
1060610366 9:124958614-124958636 AAATAGGAGAAGGCCAGGCGTGG + Intronic
1060760633 9:126245297-126245319 ACATGGCAGCAGGGCAGGAGAGG + Intergenic
1060905191 9:127298467-127298489 ACCTGGAAGCAGGCCGGGCGTGG - Intronic
1060939150 9:127533712-127533734 GGAAGGCAGCATGCCAGGCTAGG + Intronic
1061092170 9:128432850-128432872 AAATAGCAGGAGGCCAGGCCAGG + Intronic
1061152957 9:128839252-128839274 AGTGGGCATCAGGCCAGGCACGG - Intronic
1061192079 9:129087912-129087934 AGGTGGAGGCCGGCCAGGCGGGG - Intronic
1061197586 9:129115931-129115953 AGGAGGCAGTTGGCCAGGCGCGG - Intronic
1061233631 9:129329259-129329281 AGATGGGAGTAGGCCGGGCGTGG + Intergenic
1061358881 9:130127991-130128013 AGATGGAAGGAGGCCAAGTGTGG - Intronic
1061801647 9:133116229-133116251 AGATGACAGGAGGCCAGCCCGGG + Intronic
1062045333 9:134422231-134422253 AGATGGGAGCATCCCAGGAGTGG - Intronic
1062460252 9:136659931-136659953 TGAGGGGAGGAGGCCAGGCGTGG + Intronic
1203487447 Un_GL000224v1:70195-70217 AAATAACATCAGGCCAGGCGTGG + Intergenic
1203500068 Un_KI270741v1:12090-12112 AAATAACATCAGGCCAGGCGTGG + Intergenic
1185600178 X:1333715-1333737 CCATGGCGGCAGGCCGGGCGCGG - Intergenic
1185645788 X:1614726-1614748 AGATGCCAGCAGGCCAGCCTGGG - Intergenic
1185678813 X:1871361-1871383 AGATGTGGGCAGGCCGGGCGCGG - Intergenic
1185679034 X:1873148-1873170 AGATGTGGGCAGGCCGGGCGCGG - Intergenic
1186303058 X:8221444-8221466 AGATGGAAGTCGGCCGGGCGTGG - Intergenic
1186465250 X:9779717-9779739 GGGTGACAGTAGGCCAGGCGCGG - Intronic
1186477059 X:9865848-9865870 AGGCAGCAGGAGGCCAGGCGCGG - Intronic
1187105708 X:16239317-16239339 AAATGGCTGTATGCCAGGCGTGG + Intergenic
1187308542 X:18119247-18119269 AGAGGGGAGATGGCCAGGCGTGG + Intergenic
1187867462 X:23737020-23737042 AGAACCCCGCAGGCCAGGCGTGG + Intronic
1187907772 X:24083573-24083595 ACTTAGCAGGAGGCCAGGCGCGG + Intergenic
1188107247 X:26159979-26160001 AGATGGCAGCAGGTCAGCGAGGG + Intergenic
1188110606 X:26192942-26192964 AGATGGCAGCAGGTCAGTGAGGG + Intronic
1188291409 X:28393154-28393176 AGTTGGAAGCAGGCCAGGCACGG - Intergenic
1188498884 X:30804971-30804993 AGAAGGCAGAAGGCAAGGCAAGG - Intergenic
1189240830 X:39523119-39523141 AGGTGGCAGCAGGCAGGGCTGGG - Intergenic
1189464589 X:41268738-41268760 GGATGGCAGCAGGCAAAGAGAGG - Intergenic
1189506096 X:41613021-41613043 ACGGGGCAGCTGGCCAGGCGGGG - Intronic
1189512572 X:41677826-41677848 ACATCCCAGCAGGCCAGGGGAGG - Intronic
1189642712 X:43090288-43090310 AAATGGCAGCAGGCCTGGCATGG - Intergenic
1189837590 X:45040373-45040395 ACAGGGCGGCTGGCCAGGCGGGG + Intronic
1189846045 X:45139350-45139372 AGAGTGCAGTAGGCCAGGTGCGG - Intergenic
1189897177 X:45667712-45667734 TGATTGAAGCAGGCCAGGTGTGG + Intergenic
1190305237 X:49078229-49078251 AGATAAAAACAGGCCAGGCGTGG + Intronic
1190505210 X:51119532-51119554 ACAGGGCGGCTGGCCAGGCGGGG + Intergenic
1190845479 X:54186849-54186871 AAAGGGAAGCAGGCCAGGCTTGG + Intergenic
1190964750 X:55288390-55288412 AGAGGAAAGCAGGCCAGGCTCGG - Intronic
1191009937 X:55748797-55748819 ACGGGGCAGCTGGCCAGGCGGGG - Intronic
1191637418 X:63393366-63393388 AGGGGGCGGCTGGCCAGGCGGGG - Intergenic
1192118085 X:68430530-68430552 AGAAGGAAAGAGGCCAGGCGTGG + Intronic
1192141784 X:68652427-68652449 AGGTGGCAAAAGGCCAGGCCAGG + Intronic
1192173871 X:68874043-68874065 GGATGCCAGGAGGCCAGGCTGGG + Intergenic
1192321635 X:70094891-70094913 ATATGGGAGCTGGCCCGGCGCGG - Intergenic
1192467918 X:71370638-71370660 AGTTTCAAGCAGGCCAGGCGGGG - Intronic
1192621426 X:72681860-72681882 ACAGGGCAGCTGGCCGGGCGGGG - Intronic
1192764338 X:74126738-74126760 GAAGGGCTGCAGGCCAGGCGTGG + Intergenic
1193068115 X:77279593-77279615 ACAGGGCAGCTGGCCGGGCGGGG - Intergenic
1193123577 X:77848360-77848382 AGCTAGTAGAAGGCCAGGCGTGG + Intronic
1193125455 X:77865863-77865885 AGAGTGCATCAGGCCAGGCGTGG + Intronic
1193164584 X:78265546-78265568 ACAGGGCGGCTGGCCAGGCGGGG + Intergenic
1193325871 X:80178081-80178103 AGAAGGCAGCAAGCCAGGAAGGG + Intergenic
1193917509 X:87383162-87383184 GGATGGCAGCAGGCAAAGAGAGG - Intergenic
1194257068 X:91647073-91647095 GGATGGCAGCAGGCAAAGAGAGG - Intergenic
1194285931 X:92009993-92010015 AAAATGCAACAGGCCAGGCGAGG - Intronic
1194875397 X:99180810-99180832 AGATATAAGCAGGCCGGGCGTGG - Intergenic
1195043698 X:101037078-101037100 AGAGGGCAGAAGGACAGGAGGGG + Intronic
1195069978 X:101269609-101269631 GGATGGCAGCAGGCAAAGAGAGG + Intronic
1196101251 X:111849495-111849517 ACATGGCAGAAGGCCAGGTTTGG + Intronic
1196731394 X:118944498-118944520 AGATACCAGGAGGCCAGGCGTGG - Intergenic
1196792054 X:119472712-119472734 AAATGGCTTGAGGCCAGGCGTGG - Intergenic
1197669394 X:129259529-129259551 AGAAGGCAGCAGGACGGGCCAGG - Intergenic
1197787964 X:130219194-130219216 AGAAGTCAGAGGGCCAGGCGTGG + Intronic
1197814687 X:130484998-130485020 AAATATCAGCAGGCCGGGCGTGG - Intergenic
1197975534 X:132162402-132162424 GGATGGCAGCAGGCAAAGAGAGG - Intergenic
1198029829 X:132744076-132744098 AGAATGCTGCAGGCCAGGCATGG - Intronic
1198253968 X:134908975-134908997 AGGAGGCTGCAGGCCGGGCGCGG + Intronic
1198866543 X:141129313-141129335 AAATGAGAGAAGGCCAGGCGCGG + Intergenic
1199342252 X:146694515-146694537 AGAGGAATGCAGGCCAGGCGTGG - Intergenic
1199491154 X:148402207-148402229 GGATGGCAGCAGGCAAAGAGAGG + Intergenic
1199744025 X:150760631-150760653 ATATGTGAGTAGGCCAGGCGCGG + Intronic
1199792332 X:151167093-151167115 AAAGAGCAGCTGGCCAGGCGCGG + Intergenic
1200245947 X:154525566-154525588 TGATGGTCGCTGGCCAGGCGTGG - Intergenic
1200306560 X:155031616-155031638 AAATAGAAGCAGGCCAGGCACGG - Intronic
1200575778 Y:4886339-4886361 GGATGGCAGCAGGCAAAGAGAGG - Intergenic
1200629110 Y:5559681-5559703 GGATGGCAGCAGGCAAAGAGAGG - Intronic
1201902602 Y:19058647-19058669 AAAAGGCTGCAGGCCAGGCGAGG - Intergenic