ID: 1033285413

View in Genome Browser
Species Human (GRCh38)
Location 7:140037033-140037055
Sequence TGGCAGCAGGCCAGGCGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4467
Summary {0: 1, 1: 4, 2: 79, 3: 682, 4: 3701}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033285404_1033285413 17 Left 1033285404 7:140036993-140037015 CCGTTAAACCCATCAACTCCAAA 0: 1
1: 0
2: 0
3: 22
4: 357
Right 1033285413 7:140037033-140037055 TGGCAGCAGGCCAGGCGCGGTGG 0: 1
1: 4
2: 79
3: 682
4: 3701
1033285403_1033285413 21 Left 1033285403 7:140036989-140037011 CCATCCGTTAAACCCATCAACTC 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1033285413 7:140037033-140037055 TGGCAGCAGGCCAGGCGCGGTGG 0: 1
1: 4
2: 79
3: 682
4: 3701
1033285407_1033285413 -1 Left 1033285407 7:140037011-140037033 CCAAAGTCGCCTACAGAAAAGAT 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1033285413 7:140037033-140037055 TGGCAGCAGGCCAGGCGCGGTGG 0: 1
1: 4
2: 79
3: 682
4: 3701
1033285405_1033285413 9 Left 1033285405 7:140037001-140037023 CCCATCAACTCCAAAGTCGCCTA 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1033285413 7:140037033-140037055 TGGCAGCAGGCCAGGCGCGGTGG 0: 1
1: 4
2: 79
3: 682
4: 3701
1033285409_1033285413 -10 Left 1033285409 7:140037020-140037042 CCTACAGAAAAGATGGCAGCAGG 0: 1
1: 0
2: 3
3: 28
4: 263
Right 1033285413 7:140037033-140037055 TGGCAGCAGGCCAGGCGCGGTGG 0: 1
1: 4
2: 79
3: 682
4: 3701
1033285406_1033285413 8 Left 1033285406 7:140037002-140037024 CCATCAACTCCAAAGTCGCCTAC 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1033285413 7:140037033-140037055 TGGCAGCAGGCCAGGCGCGGTGG 0: 1
1: 4
2: 79
3: 682
4: 3701
1033285402_1033285413 25 Left 1033285402 7:140036985-140037007 CCTACCATCCGTTAAACCCATCA 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1033285413 7:140037033-140037055 TGGCAGCAGGCCAGGCGCGGTGG 0: 1
1: 4
2: 79
3: 682
4: 3701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033285413 Original CRISPR TGGCAGCAGGCCAGGCGCGG TGG Intronic
Too many off-targets to display for this crispr