ID: 1033285597

View in Genome Browser
Species Human (GRCh38)
Location 7:140038151-140038173
Sequence CACGGCAGCCATTCAAATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033285596_1033285597 -9 Left 1033285596 7:140038137-140038159 CCTAGGACAGAGGACACGGCAGC 0: 1
1: 0
2: 1
3: 27
4: 245
Right 1033285597 7:140038151-140038173 CACGGCAGCCATTCAAATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033285597 Original CRISPR CACGGCAGCCATTCAAATGC CGG Intronic
No off target data available for this crispr