ID: 1033287244

View in Genome Browser
Species Human (GRCh38)
Location 7:140051999-140052021
Sequence CAGTCACAGCAGAAGTGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033287244_1033287247 -3 Left 1033287244 7:140051999-140052021 CCTGATCACTTCTGCTGTGACTG 0: 1
1: 0
2: 1
3: 25
4: 231
Right 1033287247 7:140052019-140052041 CTGGGCCACTTCCCCCTTTTAGG No data
1033287244_1033287255 28 Left 1033287244 7:140051999-140052021 CCTGATCACTTCTGCTGTGACTG 0: 1
1: 0
2: 1
3: 25
4: 231
Right 1033287255 7:140052050-140052072 CTTTGTCTCCAGGATCCTACTGG 0: 1
1: 6
2: 53
3: 178
4: 287
1033287244_1033287253 18 Left 1033287244 7:140051999-140052021 CCTGATCACTTCTGCTGTGACTG 0: 1
1: 0
2: 1
3: 25
4: 231
Right 1033287253 7:140052040-140052062 GGAGCCATTGCTTTGTCTCCAGG 0: 1
1: 0
2: 3
3: 36
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033287244 Original CRISPR CAGTCACAGCAGAAGTGATC AGG (reversed) Intronic
905954687 1:41982439-41982461 CAGCCACAGCAGAAATCAACAGG + Intronic
907915604 1:58866007-58866029 CAGTCACATCAGAACTTACCTGG + Intergenic
908887376 1:68804970-68804992 CAGTTCCAGGAGAAATGATCAGG - Intergenic
908973419 1:69865834-69865856 CAGTCACCTCAGGAGTGACCTGG + Intronic
909427818 1:75547524-75547546 CAGTCAAAGCAAAAGTGTCCTGG + Intronic
909835464 1:80249038-80249060 CAATCACAGCAGACTTGAACTGG - Intergenic
910084679 1:83385377-83385399 CAGTCAAAACAGAAGGCATCAGG + Intergenic
910103002 1:83598626-83598648 CAGTCACAGCAGAAGGCAAAGGG - Intergenic
912053769 1:105568609-105568631 CAGTCAAAGCAAAAGTGGACTGG - Intergenic
912256766 1:108067602-108067624 CAGTCACAACAGAAGCTCTCTGG + Intergenic
912566668 1:110592486-110592508 CAGTCCCAGCAGGAGGGACCAGG + Intergenic
912662727 1:111547976-111547998 CAGTCAAAGCAAAAGTGAACTGG - Intronic
913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG + Intergenic
914448174 1:147768009-147768031 CAGCCTCAGGAGAAATGATCAGG + Intronic
916787571 1:168097553-168097575 CAGCAGCAGCAGAATTGATCTGG - Intronic
917176496 1:172241734-172241756 GAATCACAGCAGAGGTGATGGGG - Intronic
917381599 1:174416101-174416123 CTGTCACAGCAGAAGTGAGTTGG - Intronic
920313538 1:205062203-205062225 CAGCCACAAAAGAAGTGATGTGG + Intronic
922284851 1:224161752-224161774 CAGACACAACAGAAGAAATCTGG - Exonic
922334846 1:224610511-224610533 CAATCACAGCAGAAGGCAACGGG - Intronic
922561379 1:226572202-226572224 CATTCACAGCACAGGTGTTCTGG + Intronic
923126387 1:231038294-231038316 CAGTCACACCAGGAGGGACCTGG + Intronic
923216906 1:231856866-231856888 CAGTAAAAGCCGGAGTGATCAGG + Intronic
1062797387 10:354735-354757 CACTTTCAGCAGAAGGGATCTGG + Intronic
1065100223 10:22324499-22324521 CAGTCACACAAGAAGTTTTCTGG + Intronic
1065298722 10:24301607-24301629 CACTTTCAGCTGAAGTGATCTGG - Intronic
1066526469 10:36284416-36284438 CAGTCCCAGTAGAAGGGACCAGG - Intergenic
1067004183 10:42645769-42645791 CAGTCACAGGAGCAGTGCGCTGG + Intergenic
1067755952 10:49005392-49005414 CAGTCACAGCAACAGTGGACGGG + Intergenic
1068909805 10:62367378-62367400 CACTCATGGCAGAAGTGAACAGG - Intergenic
1076419728 10:130322467-130322489 CAGTCACAGCTGAAGGGAAGGGG + Intergenic
1076459099 10:130626760-130626782 CAGACACAGAAGAAGGGATGGGG + Intergenic
1078473936 11:11614270-11614292 CAATCACAGCAGAAGGTAACAGG + Intronic
1078715175 11:13832903-13832925 CAGGCAGAGCATAAGTGCTCCGG - Intergenic
1080126438 11:28740020-28740042 CAGTCACAACACAAGTAATTTGG + Intergenic
1080953097 11:37059247-37059269 CAGTTACAAAACAAGTGATCTGG - Intergenic
1081009195 11:37786672-37786694 CAGTCAAAGCAAAAGTGAATAGG + Intergenic
1082826761 11:57585518-57585540 CAGCCACAGCAGAAGTTAGCAGG + Intergenic
1082985733 11:59169512-59169534 CAGTCAAAGCAAAAGTGCACTGG - Intergenic
1083149183 11:60781098-60781120 CTGTCTCAGCAAAAGAGATCTGG - Intergenic
1084248702 11:67879017-67879039 CAGTCACAGTATACGTGAGCCGG + Intergenic
1084539548 11:69777242-69777264 AATTCCCAGCAGAACTGATCTGG + Intergenic
1084824121 11:71716444-71716466 CAGCCACAGCATACGTGAGCCGG - Intergenic
1087076813 11:94133343-94133365 GGGTCACTGCAGAAGTGATGTGG + Intronic
1089517445 11:119042394-119042416 GATTCACAGCAGAATTGAGCAGG - Intergenic
1090683483 11:129087864-129087886 CATTCACAGCAAAATTGAACAGG - Intronic
1091120372 11:133052605-133052627 CAGAGCCAGCAGAACTGATCTGG - Intronic
1092418979 12:8314419-8314441 CAGTCACAGTATACGTGAGCCGG + Intergenic
1092836665 12:12496023-12496045 CAGTAACAGCTGAAGTGATATGG + Intronic
1093441996 12:19209716-19209738 TAGTCAAAGCAAAAGTGAACTGG + Intronic
1094018887 12:25893350-25893372 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1094129210 12:27056645-27056667 CAGTCAAAGCAAAAGTGGACTGG - Intronic
1094391694 12:29958682-29958704 CACTCACAGCAGCAGAGAACTGG + Intergenic
1096505072 12:52087528-52087550 CAGCCACAGCAGATGTGGCCAGG - Intergenic
1097057247 12:56257628-56257650 CATTCCCAGCCCAAGTGATCTGG + Intronic
1098864176 12:75743326-75743348 CAGTCAAAGCAAAAGTGAATCGG + Intergenic
1099867789 12:88305351-88305373 CAGTCAAGACAGAGGTGATCTGG + Intergenic
1099979684 12:89584059-89584081 CAGTCACAGCAGGAGCGAGGTGG - Intergenic
1102037111 12:109777311-109777333 CCTTCACTGCAGAAGTGGTCTGG + Intergenic
1103075761 12:117981281-117981303 CAGTCACAGCAGAGGTGGGAGGG - Intergenic
1104922383 12:132297611-132297633 CAGTCATCTCAGAAGTGAGCTGG - Intronic
1105404865 13:20125333-20125355 CAGTCACAGAGCATGTGATCTGG + Intergenic
1106142464 13:27022703-27022725 CTGTCACAGCAGCAGTGCTTAGG + Intergenic
1106507416 13:30383269-30383291 CAGGCACAGTAGGAGTGTTCTGG - Intergenic
1106990295 13:35411053-35411075 CAGTCAAAGCAAAAGAGAACTGG - Intronic
1107164118 13:37265443-37265465 CAATCACAGCAGAAGGGAAAGGG - Intergenic
1110019665 13:70454876-70454898 CAGTTACAGCAGAAGGGAAGAGG + Intergenic
1110717671 13:78725771-78725793 CAGCCAAAGCAGAAATGATAAGG + Intergenic
1111000727 13:82176931-82176953 TATTCACAGCAGAAATGATTTGG + Intergenic
1113115149 13:106867312-106867334 CAGTCACAGCAAACGTGCCCTGG - Intergenic
1114024424 14:18511968-18511990 CAGAAACAGCAGCAGTGTTCTGG - Intergenic
1114367878 14:22049578-22049600 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1114675639 14:24438522-24438544 CAGTAACAGCAGAGTTGGTCTGG - Exonic
1114819398 14:25998976-25998998 CAGTCAAAGCAAAAGAGAACTGG + Intergenic
1115823104 14:37233911-37233933 CAGTCAAAGCAAAAGTGGACTGG - Intronic
1117386545 14:55219775-55219797 CAGACAAAGCAAAAGTGAACTGG + Intergenic
1117933837 14:60878698-60878720 CAGTCAAAGCAAAAGTGGACTGG - Intronic
1118568510 14:67169414-67169436 AAGTCACAGAAAAAGTGAGCAGG - Intronic
1118830691 14:69428752-69428774 CAGTCAAAGCAGAAGTGGGTCGG + Intronic
1120815904 14:88857918-88857940 CAGCCACAGCAGAAATGATGGGG + Intronic
1202887472 14_KI270722v1_random:121311-121333 CAGACCCAGCAGCAGTGTTCTGG + Intergenic
1125002138 15:34782782-34782804 CAGTCAGAGTTGTAGTGATCTGG - Intergenic
1126308079 15:47283867-47283889 CAGCGGCAGCAGATGTGATCAGG - Intronic
1127305884 15:57705594-57705616 CAGTCACAGCAGATGTCACTTGG - Intronic
1128676780 15:69615540-69615562 CATTCAAACCAGAAGTGCTCTGG - Intergenic
1130041379 15:80407505-80407527 CTGTCATAGCAGAAGTCATGAGG - Intronic
1130515918 15:84625699-84625721 CTTTCACAGCAGAACTGAGCCGG + Intronic
1131362326 15:91804321-91804343 ATGTGACAGCCGAAGTGATCAGG + Intergenic
1131618808 15:94045281-94045303 CAGCCACAGCAGAAGTGGACCGG - Intergenic
1133734966 16:8607945-8607967 CAGTCACACCAGGAGTGACCAGG + Intergenic
1135463811 16:22668267-22668289 CAGTAATAGGAGAATTGATCTGG + Intergenic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1137328079 16:47461367-47461389 GACTCACGGCAGAAGTGAGCTGG + Exonic
1138391195 16:56670855-56670877 AAGTCACAGCAGACTTGACCAGG - Intronic
1138988855 16:62365655-62365677 CATTCCCAGCAGAAGTTGTCTGG + Intergenic
1139097728 16:63725804-63725826 CAGTCAAAGCAAAAGTGACATGG + Intergenic
1139114371 16:63931665-63931687 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1140125161 16:72112387-72112409 GAGACACAGCAGGAGAGATCAGG - Intronic
1141898773 16:86976716-86976738 CTGTCAGAGCAGGAGTGACCCGG + Intergenic
1141980375 16:87546562-87546584 CAGTGGCAGCAGAAATGGTCCGG - Intergenic
1144865131 17:18330756-18330778 CAGTCAAAGCAGATGAGGTCAGG + Intronic
1145858189 17:28182797-28182819 CAGTGTCTGCAGAAGAGATCAGG + Intronic
1149952163 17:61000132-61000154 AAGTCATAGCTGAAGTGATTAGG - Intronic
1203156698 17_GL000205v2_random:10771-10793 CAGACACAGCAGGAGTGTTCTGG + Intergenic
1203159448 17_GL000205v2_random:35774-35796 CAGACCCAGCAGCAGTGTTCTGG + Intergenic
1155006346 18:21733011-21733033 CAGTCAAAGCAAAAGTGGACCGG - Intronic
1155863097 18:30929088-30929110 CTGTCACAGTCAAAGTGATCAGG - Intergenic
1156172447 18:34502507-34502529 CAGTGACAGCAGAACTGAGAGGG - Intronic
1156255280 18:35389473-35389495 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1158540885 18:58353230-58353252 GAGTAACTGCAGAACTGATCAGG - Intronic
1159343136 18:67163147-67163169 CAGTCACAGCACAAGTGGGCTGG - Intergenic
1160481992 18:79249554-79249576 CAGTCATGGCAAAAGTTATCTGG + Intronic
1160590634 18:79942923-79942945 GAGTCACAGCAGAACTGAAAGGG + Intronic
1162222121 19:9186555-9186577 GAGTCACCGCAGAAGTGAAGTGG - Exonic
1163227248 19:15972760-15972782 GTGTCACAGCAAAATTGATCAGG - Intergenic
1163977206 19:20863437-20863459 GAGTGACAGAAGATGTGATCAGG + Intergenic
1164326317 19:24195536-24195558 CAGTAAGAGCAGAAGTCATAAGG - Intergenic
1164971470 19:32536500-32536522 CACTCACTGCAGAGGTGATGGGG - Intergenic
1166256306 19:41607102-41607124 TAGTCAGAGCAGCAGTGGTCTGG - Intronic
1202662879 1_KI270708v1_random:88155-88177 CAGACCCAGCAGCAGTGTTCTGG + Intergenic
927726642 2:25429532-25429554 CAGTCCCTGCTGAAGTGATCAGG - Intronic
928357007 2:30625999-30626021 CAGTCACAGCTGTAGTCATCTGG - Intronic
928637415 2:33261957-33261979 CACTCACACCAGATGTGACCAGG - Intronic
929244425 2:39686320-39686342 AAGGCACAACAGAAGTGTTCTGG + Intronic
929696363 2:44119624-44119646 CAATAACAGCAGAAGTGTTCTGG + Intergenic
930092279 2:47539817-47539839 CATCCACAGCTGAAGTGCTCAGG + Intronic
930326217 2:49922193-49922215 CAGGCTCAGCAGAAGTGATCCGG - Exonic
932071711 2:68627256-68627278 CAGTCTCAGCACATGTGTTCTGG - Intronic
932645771 2:73499915-73499937 CAATCACAGCAGAAGTGTAAGGG - Intronic
933260107 2:80122995-80123017 CAGAGACAGCAGAAGTGAGACGG - Intronic
934564326 2:95330077-95330099 CTGCCGCAGCAGAAGTGAGCTGG + Intronic
934986756 2:98893096-98893118 CAGGCACAGCAGCAGGGAGCGGG + Intronic
937174218 2:119910766-119910788 CAGTCACAGCAGAAGGCAAAGGG - Intronic
937183681 2:120018714-120018736 CAGTCAAAGCGGCAGTGAGCTGG - Intronic
938410407 2:131059150-131059172 CTGTCACAGCGGAGATGATCAGG + Intronic
943511230 2:188830233-188830255 CAGCCACAGCAGGAGTGGTGAGG - Intergenic
944368518 2:198953917-198953939 CTGTCAAAGCAGAAGTGACTTGG - Intergenic
945183508 2:207115913-207115935 CCTTCACAGCAGAAAGGATCTGG - Intronic
945307700 2:208274481-208274503 CAGCCACACCAGACGAGATCTGG - Intronic
945762727 2:213934444-213934466 CAGTAACTGAAGAAGAGATCTGG + Intronic
946937572 2:224737508-224737530 CAATCACAGCAGAAGAGAAAGGG - Intergenic
949031618 2:241799836-241799858 CAGGGCCAGCAGAAGTGACCAGG - Intronic
1169906771 20:10612426-10612448 CATTCTCAGCAGATGTGATTAGG + Intronic
1173905034 20:46621018-46621040 CGGTCAAAGCAAAAGTGAACTGG + Intronic
1174589988 20:51637354-51637376 CAGTCAGTGCCGAAGTGAGCAGG - Intronic
1175033482 20:55977651-55977673 CAGTCATAGCAAAAGAGAGCAGG - Intergenic
1175877685 20:62238282-62238304 CAGTCACAGCAGGAGAGAGGCGG - Intronic
1176055384 20:63143057-63143079 AAGTCACAGCAAAAGTGGACTGG - Intergenic
1178296849 21:31417391-31417413 CAGTCACAGCAGAAGGCAAAAGG + Intronic
1178400357 21:32279802-32279824 CAGTGACAGCCTGAGTGATCCGG - Intergenic
1178712403 21:34929768-34929790 CAGTGACAGCAGAAGTGACTTGG - Intronic
1179657816 21:42856098-42856120 CGGGCACAGCAGATGTGGTCTGG - Intronic
1180448590 22:15439495-15439517 CAGAAACAGCAGCAGTGTTCTGG - Intergenic
1180522623 22:16223884-16223906 CAGATCCAGCAGAAGTGTTCTGG + Intergenic
1181587537 22:23861786-23861808 CAAACACAGCAGACGTGCTCAGG + Intronic
1182013577 22:27020758-27020780 AATTCACAGCTGAAGTGACCTGG - Intergenic
1184277453 22:43418232-43418254 CAGGGACAGCAGATGTGAACTGG + Intronic
950335081 3:12187135-12187157 CAGCCACAGCAGCAGTCAGCAGG - Intronic
953356202 3:42258160-42258182 CAGCCACAGGATAAGTGACCGGG - Exonic
954287337 3:49628408-49628430 CAGAAACAGCAGATGAGATCTGG + Intronic
956923613 3:73957714-73957736 CAGTCAAAGCAAAAGTGAGCTGG + Intergenic
959739364 3:109698386-109698408 CAGTCAAAGCAGAAGTGAATAGG - Intergenic
960097805 3:113704592-113704614 CAGTCAAAGCACAAGTGAACTGG - Intergenic
960139231 3:114136373-114136395 CAGTCATGGAAGTAGTGATCAGG - Intronic
960372973 3:116863565-116863587 CTGTCACAGCAGAGGGTATCAGG + Intronic
960685158 3:120287759-120287781 CTGTCACAGCTGAAGAGCTCAGG - Intergenic
961896662 3:130173643-130173665 CAGTCACAGTATACGTGAGCCGG + Intergenic
962123969 3:132595037-132595059 CAATCACAGCATAAATGATATGG + Intronic
967571989 3:191040420-191040442 CTGTAACAGCAGAAATGATTAGG - Intergenic
967732014 3:192915887-192915909 AAGTGACATCAGAACTGATCTGG + Intronic
968715049 4:2151214-2151236 GACTCTCAGCAGTAGTGATCAGG + Intronic
969091128 4:4694732-4694754 CAGTCACAGGAGAGGTAATGAGG - Intergenic
971823525 4:31591162-31591184 TAGTCACAGCAGAAGGGAAGAGG + Intergenic
971860292 4:32093127-32093149 CAGTCAAAGCAAAAGTGGACTGG - Intergenic
973181849 4:47278558-47278580 CAATGACAGCAGAAGTAAACTGG + Intronic
973672257 4:53232841-53232863 GACTCACAGCAGAAGTGGACAGG - Intronic
974343813 4:60651704-60651726 CAGAAACAGTAGAAGTTATCTGG - Intergenic
976339818 4:83934620-83934642 GAGTTACAGCAGAAGTTGTCAGG + Intergenic
976528580 4:86122389-86122411 CAGTTAAAGCAAAAGTGAACTGG - Intronic
976841963 4:89442205-89442227 CAGTCAAAGCAAAAGTGGACTGG - Intergenic
977587459 4:98789642-98789664 CAGTCAGAGCAAAAGTGAACTGG + Intergenic
977732978 4:100377773-100377795 CAGCCAAAGCAAAAGTGAACTGG + Intergenic
977814351 4:101397115-101397137 CAGTAACAGCAGCAGTGCTCAGG - Intergenic
978247956 4:106597874-106597896 CAGGCACAGCACAACTGACCAGG - Intergenic
981854784 4:149275476-149275498 CAGTCATAGCAAAAGTGAACTGG - Intergenic
984226663 4:177043653-177043675 CAGTGAAAGGAGAAGTGTTCTGG + Intergenic
987670300 5:20998566-20998588 GAGACACAGCAGAAGTGGCCTGG - Intergenic
988963560 5:36392939-36392961 CACTCACAGCAGAAGCCCTCTGG + Intergenic
991290928 5:65033456-65033478 GACTCAGAGCAGAAGGGATCTGG - Intergenic
995220987 5:109647581-109647603 AAGTCACTGCAGATGTGATAAGG + Intergenic
995889968 5:116940195-116940217 GAGTCCCAGCTGAAGTGATCTGG - Intergenic
997402996 5:133616967-133616989 CAGTAACAGCAGAGGGGAACTGG - Intergenic
997974470 5:138432061-138432083 CTGTCACAACAGAAATGATTAGG - Intronic
999177186 5:149639820-149639842 CAGTCCCAGAAGAACTGAGCTGG + Intergenic
1002199238 5:177517765-177517787 CAGTCACAGCAGGCATGCTCTGG - Intergenic
1002199331 5:177518488-177518510 CAGTCACAGCAGGCATGCTCTGG - Intergenic
1003600672 6:7514301-7514323 CAGTCTCAGCACAAGGCATCTGG - Intergenic
1004159877 6:13204017-13204039 AATCCACAGGAGAAGTGATCTGG + Intronic
1009974459 6:70658227-70658249 CAGTAACAACAAAACTGATCTGG - Intergenic
1011596569 6:89022215-89022237 CAGTCACTGCAGAAGTGTGGTGG + Intergenic
1011787105 6:90859281-90859303 TAGTAACAGCAGCAGTGATTTGG - Intergenic
1013265452 6:108493075-108493097 CAGGAACAGCACAAGTGAGCTGG - Intronic
1013379084 6:109548910-109548932 CAGTCAAAGCAAAAGTGGACTGG + Intronic
1014488214 6:122027890-122027912 CAGACAGAACAGAAGTGAGCAGG + Intergenic
1019075516 6:169384434-169384456 CAGGGTCAGCAGAAGGGATCAGG - Intergenic
1020076335 7:5261420-5261442 CCCTCTTAGCAGAAGTGATCTGG + Intergenic
1020630455 7:10633160-10633182 CAGTTTCAGCTGAAGTGATATGG - Intergenic
1020761431 7:12271348-12271370 ACGTCACAGCAGAAGTGGGCTGG - Intergenic
1020965678 7:14865013-14865035 AAGTCACAGCAGCAGAGATGAGG + Intronic
1021759970 7:23894215-23894237 CAGTCAGAGCAGGAGGCATCTGG + Intergenic
1023380816 7:39606545-39606567 CATGCTCAGCAGAAGTCATCAGG - Intronic
1024830698 7:53451879-53451901 CAGTCACATCTGAAGTGCTGGGG + Intergenic
1025202754 7:56972153-56972175 CCTTCTTAGCAGAAGTGATCTGG - Intergenic
1025669190 7:63604773-63604795 CCTTCTTAGCAGAAGTGATCTGG + Intergenic
1026107897 7:67435444-67435466 CAGTCAAAGGGGAAGTGAGCAGG + Intergenic
1026280741 7:68919748-68919770 CAGTCATGGCAGAAGTGAAGGGG + Intergenic
1027301500 7:76841492-76841514 CAGTCAAAACAGAAGGCATCAGG + Intergenic
1028325166 7:89514942-89514964 CAGTCACAGCAAAAGTAGCCTGG + Intergenic
1031769362 7:125823721-125823743 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1032269355 7:130389471-130389493 CATTCACACCTGAAGTGATATGG - Intergenic
1033214868 7:139485986-139486008 CAGTCACAGCAAAAGTGGACAGG + Intergenic
1033287244 7:140051999-140052021 CAGTCACAGCAGAAGTGATCAGG - Intronic
1034850669 7:154490422-154490444 AGGTCACAGCAGAAGTGCTGTGG + Intronic
1035381780 7:158445307-158445329 CAGTCAGGGCAGAGGTGAGCAGG - Intronic
1040774367 8:51021397-51021419 CAATCAAAGCAGAAGGGATGGGG - Intergenic
1041904690 8:63019560-63019582 CAGTCAAAGCCAAAGTGAACTGG + Intronic
1046171365 8:110511839-110511861 CAGTCACTGCAAAACTGATCTGG + Intergenic
1046660721 8:116945995-116946017 CTGTTACAGCAGAAGTCATTTGG - Intergenic
1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG + Intronic
1049517462 8:143068870-143068892 CTGTCACTGCAGGAGTGAGCTGG + Intergenic
1052175474 9:25457291-25457313 CAGTCAAAGCAAAAGTTAACTGG - Intergenic
1052486952 9:29113809-29113831 CAGTCAAAGCAAAAGTAAACTGG + Intergenic
1053103456 9:35390655-35390677 AAGTCAGCGCAGAAGTGATGTGG + Exonic
1053719370 9:40929836-40929858 CAGACACATCGGGAGTGATCTGG - Intergenic
1054346223 9:63917942-63917964 CAGACACATCGGGAGTGATCTGG + Intergenic
1055101165 9:72467146-72467168 CAGTGAAAGCAGCAGTGAACAGG - Intergenic
1055418122 9:76106479-76106501 CCGTCACAGCTGAAGTGAACTGG + Intronic
1055793620 9:79950027-79950049 CAGTCACAACTGAAGAGACCAGG - Intergenic
1055984893 9:82048103-82048125 CAGTGACTACAGAAGTGTTCTGG + Intergenic
1056967960 9:91179944-91179966 CAGTCCGAGCAGAAGAGAGCAGG + Intergenic
1057016587 9:91657682-91657704 CAGTCCCAGCAGAGGGGATGGGG - Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060896900 9:127224466-127224488 CTGTCAGAGCAGAACTGAGCAGG + Intronic
1203495638 Un_GL000224v1:148683-148705 GGGCCACAGCAGGAGTGATCTGG + Intergenic
1203508263 Un_KI270741v1:90606-90628 GGGCCACAGCAGGAGTGATCTGG + Intergenic
1185976854 X:4730945-4730967 CAGTCAGAGTTGTAGTGATCTGG - Intergenic
1186906877 X:14120134-14120156 CAGTCACTGCTGATGTCATCAGG - Intergenic
1187521138 X:20015150-20015172 CAATCACTGCAGAAGAGAACTGG + Intronic
1189253863 X:39622246-39622268 CAGTCACAGCAGAAGGTAAAAGG + Intergenic
1191131425 X:57015799-57015821 CATTCCCAGCAGCAGTGTTCAGG + Intergenic
1191851881 X:65591374-65591396 CTGTGACAGCAGCAGTGAGCTGG - Intronic
1192201787 X:69071037-69071059 CAGGCAGAGCAGGACTGATCTGG + Intergenic
1194220764 X:91187447-91187469 CAGTCAAAGCAAAAGTGGACAGG + Intergenic
1196835533 X:119810467-119810489 CAGTCAAAGCAAAAGTGGTCTGG + Intergenic
1200486833 Y:3779372-3779394 CAGTCATAGCAAAAGTGCTTGGG + Intergenic
1201018163 Y:9625333-9625355 CAGACACAGAAGAAGTGGTCAGG - Intergenic
1201163323 Y:11183650-11183672 CAACCACAGCAGCAGTGTTCTGG - Intergenic
1201672812 Y:16543229-16543251 CAGTCATAGCAGAAGAGCTTGGG - Intergenic