ID: 1033287305

View in Genome Browser
Species Human (GRCh38)
Location 7:140052977-140052999
Sequence CTGAAACTCTCACACGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1074
Summary {0: 1, 1: 4, 2: 37, 3: 201, 4: 831}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033287304_1033287305 4 Left 1033287304 7:140052950-140052972 CCAAGTGTTAGCAAGAATATACA 0: 1
1: 1
2: 8
3: 49
4: 358
Right 1033287305 7:140052977-140052999 CTGAAACTCTCACACGTTGCTGG 0: 1
1: 4
2: 37
3: 201
4: 831

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033287305 Original CRISPR CTGAAACTCTCACACGTTGC TGG Intronic
901121948 1:6902837-6902859 CTGCAACTCTCAAACATTGCTGG + Intronic
901471883 1:9462626-9462648 CTGGAACTCTCATTCTTTGCTGG - Intergenic
901623404 1:10607503-10607525 CTAGAACTCTCAAACATTGCTGG - Intronic
901682621 1:10922875-10922897 CTGGAACTCTCATACATGGCTGG + Intergenic
901874373 1:12158585-12158607 TTGGGACTCTCACACGCTGCTGG + Intergenic
902673140 1:17989295-17989317 CTGGAAATCTCATACATTGCTGG - Intergenic
902961310 1:19964678-19964700 CTGGAACTCTCACACCTTACTGG + Intergenic
902966640 1:20009378-20009400 CCAGAACTCTCACACCTTGCTGG + Intergenic
903763698 1:25717880-25717902 CTAGAACTCTCACACACTGCTGG - Intronic
904176311 1:28631861-28631883 CTGAAACCCTCATACATTGCTGG + Intronic
904320355 1:29694156-29694178 CAGGAACTCTCATTCGTTGCTGG - Intergenic
904332582 1:29771906-29771928 CTGAAATTCTCATACACTGCTGG + Intergenic
904537959 1:31213452-31213474 CTGGAACTCTCATGTGTTGCTGG + Intronic
905021647 1:34819170-34819192 CTGGATCTCTCACACACTGCTGG + Intronic
905096993 1:35481396-35481418 CTGGAACTCTCGTATGTTGCTGG - Intronic
905109073 1:35581517-35581539 GTGGAACCCTCACACATTGCTGG - Intronic
905342014 1:37285132-37285154 CTGGATCTCTCATATGTTGCTGG - Intergenic
905525625 1:38636645-38636667 CTGGAATTCTCATACATTGCTGG + Intergenic
905663535 1:39747416-39747438 CTGAAACACTCATACATTGCTGG - Intronic
906364850 1:45199073-45199095 CTGGAACTCTCATACATTGCTGG - Intronic
906917820 1:50030554-50030576 CTAAAACTCTCATATATTGCTGG + Intergenic
907026809 1:51128316-51128338 TTGAAACTCTCACTTATTGCTGG - Intronic
907170192 1:52455820-52455842 CAGGAACTCTCACACATTGCTGG + Intronic
907279321 1:53335432-53335454 CTGGAACTCTTACACATTGTTGG - Intergenic
907948595 1:59158540-59158562 CTGGAACTCTCAAACACTGCTGG + Intergenic
909083211 1:71139973-71139995 CTGGAGCTCTCATACATTGCTGG + Intergenic
909260172 1:73478098-73478120 TTGGAACTCTCATACATTGCTGG + Intergenic
909547219 1:76861004-76861026 CTGGAACTCTCATTCATTGCAGG + Intergenic
909558932 1:76987466-76987488 TTGGAACCCTCATACGTTGCTGG + Intronic
909757763 1:79248069-79248091 TTGGAACTCTCACACATTGCTGG - Intergenic
910063915 1:83129381-83129403 CTGGAACTTTCACACATTTCTGG + Intergenic
910073621 1:83249524-83249546 CTGTAAGTCTCATATGTTGCTGG - Intergenic
910715727 1:90227137-90227159 CTGGAACTGTCATACATTGCTGG - Intergenic
911128344 1:94362892-94362914 CTGAATTACTCATACGTTGCTGG - Intergenic
911300017 1:96160975-96160997 TTGAAACTCTCATACCTTGCTGG + Intergenic
911442275 1:97941922-97941944 TTGCAACTCTCAAACATTGCTGG - Intergenic
911543150 1:99183522-99183544 CTAAAACTCTCATACATTGCTGG - Intergenic
911565581 1:99459790-99459812 CAGGAACTCTCACTCTTTGCTGG + Intergenic
913125852 1:115789213-115789235 CTGGAACTCTCAGACATTTCTGG + Intergenic
913129237 1:115824312-115824334 TTGGAACTCTCATACATTGCTGG - Intergenic
913235375 1:116776481-116776503 CAGGAACTCTCAAACATTGCTGG + Intergenic
913249205 1:116898194-116898216 CTGAAACTCTCATATGTTTGTGG + Intergenic
913290331 1:117266170-117266192 CTCAAACTCTCACATGTATCAGG + Intergenic
913338840 1:117735949-117735971 CTGGAATTCTCACACATTGCTGG - Intergenic
913523326 1:119667069-119667091 CTGAAACTCTCAAACATTATTGG - Intronic
914217061 1:145641037-145641059 CTGGATCACTCATACGTTGCTGG + Intronic
914217859 1:145649763-145649785 CTGAAACTCATACACAGTGCAGG - Intronic
914470413 1:147972439-147972461 CTGAAACTCATACACAGTGCAGG - Intronic
916086161 1:161271172-161271194 CTGGAACTCTCATACGTTGTTGG - Intronic
916198257 1:162245405-162245427 CTGGAACTCTCACATAATGCTGG + Intronic
916554174 1:165878931-165878953 CAGGAACTCTCACTCATTGCTGG - Intronic
916725898 1:167523709-167523731 CTGAAACTCTCATACGCGGATGG + Intergenic
916759643 1:167804829-167804851 CGGGAACTCTCACTCGTTGCTGG - Intergenic
917379107 1:174383820-174383842 CTGCAACTCTCATATGTTGCTGG + Intronic
917801502 1:178574803-178574825 CTGAATCTCTCATACATTGCTGG - Intergenic
918161712 1:181907253-181907275 CTGAAACTCTAATCCATTGCTGG - Intergenic
918317766 1:183336589-183336611 CTGGAATTCTCATACGTTGCTGG + Intronic
918461400 1:184780714-184780736 CTGGAACTTTCATACATTGCTGG - Intergenic
918486205 1:185031250-185031272 ATGAAACTCTCATACACTGCTGG + Intergenic
918498969 1:185172673-185172695 TGGACACTCTCACATGTTGCTGG - Intronic
918509480 1:185294781-185294803 CTTGAACTCTCATACATTGCTGG - Intergenic
918760719 1:188402322-188402344 CTGGAACTCACACATGTTCCTGG + Intergenic
919323282 1:196070801-196070823 CAGAAACTCTCATTCCTTGCTGG - Intergenic
919716506 1:200783156-200783178 CTGGAACGCTCAGACATTGCTGG - Intronic
920167924 1:204049157-204049179 CTGGAACTCTCATAAGTTGCTGG - Intergenic
920289363 1:204907078-204907100 CTGGAACTCACATACATTGCTGG - Intronic
920289986 1:204914716-204914738 CAGGAACTCTCATACATTGCTGG + Intronic
920733068 1:208506522-208506544 CTGGAACTCTCATGCATTGCTGG + Intergenic
920772071 1:208897200-208897222 CTGGATCACTCACACATTGCTGG - Intergenic
920903855 1:210140074-210140096 CTGAAACTCTCATACATTGCTGG - Intronic
921519332 1:216140476-216140498 ATGAAACTTTTACACGTGGCTGG + Intronic
921563690 1:216689996-216690018 CTGAAAATCACATATGTTGCTGG + Intronic
921731121 1:218579510-218579532 CTGAAACTCTCCTGCATTGCTGG - Intergenic
922475240 1:225902469-225902491 CAGAAACTCTCACTCGTTGCTGG + Intronic
922656067 1:227384876-227384898 CAGAAACGCTCACTCTTTGCTGG + Intergenic
922679650 1:227581872-227581894 ATGAAACTCTCATGCGCTGCTGG - Intronic
923165194 1:231354883-231354905 CTAAAACTCTCATACATTGCTGG - Exonic
923452371 1:234130699-234130721 ATGAAACTCTCATACACTGCTGG + Intronic
923580401 1:235205885-235205907 CTGGAACCCTAACACATTGCTGG + Intronic
923794327 1:237138918-237138940 TTGAAACTCTCATACACTGCTGG + Intronic
924751461 1:246896094-246896116 CTGGAACTCTCATACACTGCTGG + Intronic
1063257343 10:4342802-4342824 CTGGAACCCTCACACATTGCTGG + Intergenic
1064143180 10:12807160-12807182 CTGAATCTCTCACATGTACCTGG + Intronic
1064908698 10:20376647-20376669 ATGAAAGTCTCATACATTGCTGG - Intergenic
1064977376 10:21132600-21132622 ATGGAACTCTCACACATCGCAGG - Intronic
1065257708 10:23889269-23889291 CTGAAACTCTCATACATTTCAGG - Intronic
1065270324 10:24024680-24024702 ATGAAATTCTCATACATTGCTGG - Intronic
1066240497 10:33529668-33529690 CTAGAACTCTCATACATTGCTGG + Intergenic
1066279703 10:33904148-33904170 CTGGAACTCTCATACCCTGCTGG - Intergenic
1066433636 10:35376195-35376217 TTGAAACTCTCATACATTGCTGG + Intronic
1067086954 10:43247287-43247309 CTGAAACTCTCATACTTTGCTGG + Intronic
1067658238 10:48213354-48213376 CAGGAACTCTCAGTCGTTGCTGG + Intronic
1067677631 10:48398472-48398494 CTGGACCTCTCACATGTTGCTGG + Intronic
1067826674 10:49579095-49579117 CAGGAACTCTCATTCGTTGCAGG - Intergenic
1068235045 10:54222600-54222622 CTGAAATGCTCATACATTGCTGG - Intronic
1068640155 10:59395373-59395395 CTGGAACTTTCATACATTGCTGG - Intergenic
1069048575 10:63768458-63768480 CTGGAACTCTCACACATTGGTGG - Intergenic
1069058601 10:63870380-63870402 CTGGAATTCTCATACATTGCTGG - Intergenic
1069789152 10:71008581-71008603 CTGGAACTCTCGCTCATTGCTGG - Intergenic
1069796449 10:71055313-71055335 CAGAAACTCTCATTCATTGCTGG + Intergenic
1070070654 10:73086058-73086080 CTGGAACTCTGATACATTGCTGG + Intronic
1070084523 10:73223630-73223652 CTGGAACTCTCACACAATACTGG - Intronic
1070090479 10:73279988-73280010 CTGGAACTCTCAAACATTCCTGG - Intronic
1070214787 10:74365822-74365844 CTGGAACCCTCATAAGTTGCTGG - Intronic
1070229775 10:74552952-74552974 CTGGAACTCTCATTCTTTGCTGG + Intronic
1070482300 10:76894847-76894869 CTGGAACTCTCACACACTGCTGG + Intronic
1071406551 10:85339820-85339842 TAGAAACTCTCACTCATTGCTGG + Intergenic
1071406668 10:85341128-85341150 CTGGAACTCTTATACATTGCTGG + Intergenic
1071664141 10:87537273-87537295 CTGAAACTCTCATACATTGGTGG - Intronic
1071833575 10:89396215-89396237 TTGAAACCCTCATACATTGCTGG - Intronic
1072076314 10:91977679-91977701 CAGGAACTCTCACTCATTGCTGG - Intronic
1072260884 10:93671374-93671396 CTGGCATTCTCACACATTGCTGG + Intronic
1072837698 10:98734467-98734489 CTGAAACCTTCACACACTGCTGG - Intronic
1072877414 10:99187763-99187785 CTTTAACTTTCACACATTGCTGG + Intronic
1072894286 10:99352481-99352503 TTGAACCTCTCAGACATTGCTGG - Intronic
1072924496 10:99604578-99604600 CTGGAACTCTCATACATTGCTGG + Intergenic
1073342984 10:102759980-102760002 TTGAAACTCTCATACATTGCTGG - Intronic
1073631391 10:105153551-105153573 CTGCTACTCTCATACCTTGCTGG - Intronic
1073896914 10:108172257-108172279 CTGAAACTCTCCGACTTTGATGG - Intergenic
1074265287 10:111896068-111896090 CTGAATCTCTCATACATTTCTGG + Intergenic
1074481371 10:113824574-113824596 ATGGAACTCTCATACATTGCTGG + Intergenic
1074644260 10:115427091-115427113 CTGAAACTCTCATACACTGCTGG - Intronic
1074658943 10:115628202-115628224 CTGAAACTCGCATACATCGCTGG - Intronic
1074667453 10:115745575-115745597 CTGAAACTCTCATGTGTTGTGGG - Intronic
1074806562 10:117059233-117059255 CTGAATCACTCACACATTGCTGG + Intronic
1075114894 10:119618020-119618042 CTGAAACTCAGAGACGTTCCAGG + Intergenic
1075429391 10:122367619-122367641 CTGGAACTCTCATACACTGCTGG + Intergenic
1075431857 10:122390910-122390932 CTGGAACCCTCCTACGTTGCTGG - Intronic
1075543195 10:123333135-123333157 CTGGAACTCTCACACATTGCTGG + Intergenic
1075582079 10:123627023-123627045 CTGAAACTCTCGTACACTGCTGG - Intergenic
1075696312 10:124438230-124438252 TTGCAACTCTCGCACATTGCTGG + Intergenic
1075717177 10:124562999-124563021 CTGAATCACTCAGACATTGCTGG + Intronic
1076268058 10:129125913-129125935 CTAGAACTCTCACACATTGGTGG + Intergenic
1077031014 11:467375-467397 CAGGAACTCTCACCCATTGCTGG + Intronic
1077908540 11:6554778-6554800 CTGAAACTCTCTCACTTTGATGG + Intronic
1078115984 11:8451107-8451129 CTGGAACCCTCACAAATTGCTGG + Intronic
1078401545 11:11032239-11032261 CAGACACTCTTACACATTGCTGG - Intergenic
1078521132 11:12064521-12064543 GTGGAACTCTCATACGTTGCTGG - Intergenic
1078539692 11:12203378-12203400 TTGAAACCCTCATACATTGCTGG - Intronic
1078635814 11:13048847-13048869 CGGAAACTCTCATACACTGCTGG - Intergenic
1078803849 11:14675997-14676019 CTGGAACTCTCATATATTGCTGG - Intronic
1078903061 11:15659425-15659447 TTGAAACTCTTACATGCTGCTGG + Intergenic
1078988863 11:16624739-16624761 TTGAAATTCTCATACATTGCTGG - Intronic
1079118598 11:17658493-17658515 TTGAAACCCTCATACATTGCTGG + Intergenic
1079277348 11:19053789-19053811 CTGGAACTCTCATACATTGCTGG + Intergenic
1079338638 11:19593658-19593680 CTGAATCACTCACACATTGCTGG - Intronic
1081624413 11:44640244-44640266 CAGAAACCCTCACACATTGCTGG + Intergenic
1081838832 11:46180273-46180295 CTGGATCTCTCATACGTTGCTGG - Intergenic
1081851344 11:46277271-46277293 CTGAAAATCTCCCCCGTTGAGGG + Intergenic
1081954992 11:47084023-47084045 CTGGAATTCTCATACATTGCTGG - Intronic
1083210049 11:61177988-61178010 CAGAAACTCTCATTCGTTGCTGG + Intergenic
1083286247 11:61660992-61661014 CTGAAACCCTCACACATGGTTGG + Intergenic
1083483286 11:62963983-62964005 CTGGAACTCTCATCCATTGCTGG - Intronic
1084152174 11:67293264-67293286 CTGGAACCCTCACATGCTGCTGG - Intronic
1084241903 11:67827084-67827106 CTCAAAGTCACACAGGTTGCAGG - Intergenic
1084702082 11:70793707-70793729 CTGGAACTCTCACACACTGCCGG + Intronic
1085004886 11:73078219-73078241 CTGGAACTCTCATACATTGCTGG + Intronic
1085017148 11:73181864-73181886 CTGGAACTCTCACACACTGCTGG - Intergenic
1085152032 11:74260023-74260045 CTGGAACTCTCATGCGTTGCTGG - Intronic
1085547994 11:77338488-77338510 CTGGAACCCTCATACATTGCTGG + Intronic
1085681492 11:78579199-78579221 CTGAAACTCTCATATATGGCTGG - Intergenic
1086068731 11:82775565-82775587 TTGAAACACTCACACATTTCTGG + Intergenic
1086111625 11:83205036-83205058 CTGGAACTCCCATACATTGCTGG + Intronic
1086244707 11:84738655-84738677 CTGAAACTCCCCTACATTGCTGG + Intronic
1086382401 11:86270109-86270131 CTGGATCTCTCATACATTGCTGG - Intronic
1086473202 11:87139664-87139686 CTGGAACTCTCATATATTGCTGG - Intronic
1087413560 11:97823714-97823736 TTGAACCTCTCATACATTGCTGG - Intergenic
1088378579 11:109168713-109168735 CAGAAACACTCACACGTTAGGGG - Intergenic
1088616069 11:111629841-111629863 CTAGAACTCTCATACATTGCTGG + Intronic
1088697574 11:112381562-112381584 CTGGAACTCTCATACATTGCTGG - Intergenic
1089223152 11:116892594-116892616 CAGAAGCTCTCACTCATTGCTGG + Intronic
1089241227 11:117082156-117082178 CAGAAACCCTCATACATTGCAGG + Intronic
1089446102 11:118553532-118553554 CTGGAACTCTCATTCATTGCTGG + Intronic
1089941162 11:122418983-122419005 CTGAAAGTCTCACACCTTTGGGG + Intergenic
1090112715 11:123932321-123932343 CTGGAACTCTCATTCATTGCTGG - Intergenic
1090138197 11:124222720-124222742 CTCAAGCTCTCACACATAGCTGG - Intergenic
1090746778 11:129711935-129711957 CAGAAACTCTCACGTATTGCTGG - Intergenic
1091359895 11:134970540-134970562 TTGAAACCCTCCCACATTGCAGG + Intergenic
1092038861 12:5365540-5365562 CAGAAACTCTCATTCATTGCTGG + Intergenic
1092177065 12:6417293-6417315 CTGGAACTCTCATAAATTGCTGG + Intergenic
1092338990 12:7659583-7659605 CTGAATCTGTCATACTTTGCTGG + Intronic
1092507712 12:9121141-9121163 CTGTAACCCTAACACTTTGCGGG - Intergenic
1092771216 12:11898790-11898812 CTGGAACCCTCATACATTGCTGG + Intergenic
1093249033 12:16777379-16777401 CTGAAATTCTCTTACATTGCTGG + Intergenic
1093280353 12:17186997-17187019 GTGATACTCTCACATGTAGCTGG - Intergenic
1093486000 12:19653137-19653159 CTCAAACTCTCACACAGTCCAGG - Intronic
1093696685 12:22168996-22169018 TTGGAACTCTCAAACATTGCTGG + Intronic
1093906625 12:24701081-24701103 CTGGAATTCTCATACATTGCTGG + Intergenic
1093975535 12:25416739-25416761 TTGGCTCTCTCACACGTTGCTGG - Intronic
1094007185 12:25767494-25767516 CTGGAACTGTCATACGCTGCTGG - Intergenic
1094686044 12:32715796-32715818 TTGGAACTCTCACACGTTGCTGG + Intronic
1094686147 12:32716988-32717010 TTGGAACTCTCACACGTTGCTGG - Intronic
1094789031 12:33888541-33888563 CTGGAACTCTCATACATTGCTGG + Intergenic
1095537315 12:43266230-43266252 CTGGAACTCTCATACATTGTGGG + Intergenic
1096511062 12:52128961-52128983 CAGAATTTCTCACACATTGCTGG + Intergenic
1096637037 12:52966635-52966657 ATGAAACCCTCATATGTTGCTGG + Intergenic
1096858677 12:54506234-54506256 CTGAAGCTCTCATACATTACTGG - Intronic
1098039538 12:66340232-66340254 CTGGAACTCTCATACACTGCTGG - Exonic
1098475996 12:70904086-70904108 CTGGAAGTCTCAGACCTTGCAGG + Intronic
1098565933 12:71935872-71935894 GTGGAACACTCACACATTGCTGG - Intergenic
1098940964 12:76535483-76535505 CTGGAACTCTCATACATTGCTGG + Intronic
1098993040 12:77086952-77086974 CTGTAATTCTCACACATTGCTGG + Intergenic
1099306263 12:80959804-80959826 CTGGAACACTCATACATTGCTGG - Intronic
1099870615 12:88344649-88344671 CAGGAACTCTCATTCGTTGCTGG - Intergenic
1100047101 12:90395909-90395931 CTGTAATTCCCACACGTTGTAGG + Intergenic
1100103177 12:91134853-91134875 CTGGAACTCTCATATATTGCTGG - Intergenic
1100410671 12:94315197-94315219 CTAGAACTCTCACATATTGCTGG - Intronic
1100905640 12:99295188-99295210 CTGGAACTCTCATACATTGCTGG - Intronic
1101331013 12:103758002-103758024 CTCAAACTCTCCCACGGCGCAGG + Intronic
1101679415 12:106950467-106950489 CTAAAACTCTCAGATGTTGTTGG - Intergenic
1101879361 12:108616048-108616070 CTAGAACACTCACATGTTGCTGG - Intergenic
1102209441 12:111114200-111114222 CTGAAACTCTCATATGTTACTGG - Intronic
1102664500 12:114558953-114558975 CTGGAACTCTCATCTGTTGCTGG - Intergenic
1102700621 12:114835902-114835924 CTGGAACTCTCATACACTGCTGG + Intergenic
1102901509 12:116641455-116641477 CTGGAACTCTCATACATTGCTGG + Intergenic
1102936444 12:116901196-116901218 CTGGAACCCTCACACAGTGCTGG + Intergenic
1103276325 12:119714706-119714728 CTGGAACCCTCACACATTCCTGG + Intronic
1103311908 12:120016787-120016809 CTGGAACTCTCACGCATTGTTGG - Intronic
1103430495 12:120881096-120881118 CTGAAACCCTTATACATTGCTGG + Intronic
1104060930 12:125267630-125267652 CTGAAACTCGCACTCATGGCTGG + Intronic
1104117941 12:125767912-125767934 CTGTAACTCTCATACATTGCTGG - Intergenic
1104360393 12:128127662-128127684 CTGGAACCCTCACACATTGCTGG + Intergenic
1104737429 12:131145029-131145051 CAGAAACTCTCATTCATTGCTGG - Intergenic
1105302305 13:19146932-19146954 CTGGAATTCTCATACATTGCTGG + Intergenic
1105435067 13:20369585-20369607 CTAAAACTCTTACATCTTGCTGG + Intergenic
1105788546 13:23773578-23773600 TTGGAACCCTCATACGTTGCTGG - Intronic
1106233643 13:27842851-27842873 TTGGAACCCTCACACATTGCTGG + Intergenic
1106577081 13:30984844-30984866 TCGTAACTCTCATACGTTGCTGG - Intergenic
1106649424 13:31673752-31673774 TTGGAACACTCACACATTGCTGG + Intergenic
1106744228 13:32682729-32682751 CTGGAACTCTCATTCATTGCTGG - Intronic
1106790280 13:33148599-33148621 CAGAAACTCTCATTCATTGCTGG + Intronic
1106815075 13:33398784-33398806 CTGGAACCCTCATACATTGCTGG + Intergenic
1106842451 13:33698734-33698756 CTGGAATTCTCATACTTTGCAGG - Intergenic
1107005952 13:35612015-35612037 CTGGAACTGTCATACATTGCTGG - Intronic
1107067287 13:36228276-36228298 CTGGAACCCTCATATGTTGCTGG - Intronic
1107234342 13:38150929-38150951 CGGGAACTCTCACTCATTGCTGG + Intergenic
1107554869 13:41508784-41508806 CAGAAACCCTCACACATAGCTGG + Intergenic
1107578496 13:41754177-41754199 CTTGAACTCCCACATGTTGCGGG + Intronic
1107668187 13:42714972-42714994 CTGGGACACTTACACGTTGCTGG - Intergenic
1107742782 13:43470896-43470918 CTAAAACTCTCACATTTTGTTGG + Intronic
1108107070 13:47022209-47022231 CTGGATCACTCACACATTGCTGG + Intergenic
1108134147 13:47337724-47337746 CTGGAACTCTCATATTTTGCTGG + Intergenic
1108333781 13:49417929-49417951 CTGGAACTCTCAAACATTGCTGG + Intronic
1108417934 13:50219647-50219669 TTGGAACTCTCATACATTGCTGG + Intronic
1108737750 13:53302889-53302911 CTGAAACTCTCACACACCCCAGG + Intergenic
1109334697 13:60979938-60979960 CTGAAATCTTCACACATTGCAGG + Intergenic
1109515053 13:63432856-63432878 CTGGAACTCTCATACTTTGCCGG + Intergenic
1109972856 13:69792427-69792449 CTGATACCCTTATACGTTGCTGG + Intronic
1111022602 13:82472733-82472755 CAGAAACTCTTACTCTTTGCTGG - Intergenic
1111545412 13:89727478-89727500 CAGAAACTCTCATTCATTGCTGG - Intergenic
1111566608 13:90025293-90025315 TTGAAACTCTCATACACTGCTGG - Intergenic
1111686982 13:91514261-91514283 CTGAATCTTTTACACATTGCTGG - Intronic
1111872850 13:93855632-93855654 CAGAAACTCTCACTCATTGCTGG - Intronic
1111965148 13:94853751-94853773 CTGAAACTCTCATACACTTCTGG + Intergenic
1112181745 13:97089564-97089586 CTGAAACTCTCACACATTGCTGG + Intergenic
1113412081 13:110099337-110099359 CTGGAACTCTCACACATTGCTGG + Intergenic
1113903772 13:113809905-113809927 CCGAAACTCACACAGGTTTCTGG - Intronic
1115167728 14:30468271-30468293 TTGGAACCCTCACACATTGCTGG + Intergenic
1115296868 14:31838172-31838194 CTGGAATTCTCATACATTGCTGG + Intronic
1115419425 14:33176833-33176855 CTGAAACCCCCATACATTGCTGG - Intronic
1115432493 14:33336059-33336081 CTGGAACCCTCACACATTGCTGG - Intronic
1116569166 14:46493135-46493157 CTGGAACTCTCATATATTGCTGG + Intergenic
1116723429 14:48529809-48529831 CAGGAACTCTCATTCGTTGCTGG - Intergenic
1116737606 14:48712905-48712927 TTGAAACTCTCACTCATTTCTGG + Intergenic
1117126229 14:52629148-52629170 CTGAAACTCTCACACTTTGTTGG + Intronic
1117136633 14:52741317-52741339 CTGGGACTCTCACACATTGCTGG - Intronic
1117266920 14:54098845-54098867 CTGGAACCCTCATACATTGCTGG + Intergenic
1117663217 14:58029731-58029753 TTAGAACTCTCATACGTTGCTGG + Intronic
1117784497 14:59268455-59268477 CTGGAACCCTCATACATTGCTGG - Intronic
1117801859 14:59452612-59452634 CAGAAACTCTCATTCATTGCTGG + Intronic
1118110907 14:62718586-62718608 CTGGAACCCTCACACATTGCTGG + Intronic
1118124044 14:62879238-62879260 CTGGAACTCTCATGCATTGCTGG + Intronic
1118580840 14:67295737-67295759 CTGAAACTCTCATACATCACTGG + Intronic
1118755604 14:68841267-68841289 CTGGAACTTTCACACATTGTTGG + Intergenic
1118829326 14:69415242-69415264 CTGGAAAACTCACACATTGCTGG - Intronic
1118976396 14:70680929-70680951 CTGAAACTCTCATACACTGCTGG + Intergenic
1119061343 14:71477971-71477993 CTGAAACTTTTATACATTGCTGG - Intronic
1119257958 14:73215824-73215846 CTGGAACTCTCAATTGTTGCTGG + Intronic
1119550626 14:75510758-75510780 CTGAAACCCTCAGATATTGCTGG + Intergenic
1119983966 14:79114895-79114917 CTTCAACTCTCACACGTCTCTGG + Intronic
1120534768 14:85680785-85680807 CTGAAAGTCTCATACATTGCTGG - Intergenic
1120658441 14:87224034-87224056 CAGAAACACTCATATGTTGCTGG + Intergenic
1120895507 14:89528040-89528062 CTGGAACTCTCATACCCTGCTGG + Intronic
1120902122 14:89584497-89584519 CGGAAACTCTCATACTCTGCTGG - Intronic
1121036899 14:90713578-90713600 CTGGAGCTCTCATACATTGCCGG + Intronic
1121147776 14:91600227-91600249 CTGGAACTCTCATGCATTGCTGG - Intronic
1121296624 14:92831144-92831166 CTGGAACTCTCACCCACTGCTGG + Intronic
1121384516 14:93507344-93507366 CTGAAACTCTCATAAATTGTTGG - Intronic
1121488178 14:94336785-94336807 TTAGAACTCTCACACATTGCTGG - Intergenic
1121662796 14:95648125-95648147 CTAGATCTCTCCCACGTTGCTGG + Intergenic
1121784096 14:96641888-96641910 CTAGAACCCTCACACATTGCTGG - Intergenic
1122024489 14:98865631-98865653 CTGAAACTGTCACACATTGCTGG + Intergenic
1122158073 14:99762841-99762863 CTGGAACTCACACATGTTACTGG + Intronic
1122276933 14:100595785-100595807 CTGAATCTCTCATACTCTGCTGG - Intergenic
1122395275 14:101423597-101423619 CTGGAACTCTCATACATTGTTGG + Intergenic
1122568779 14:102678744-102678766 CTGAAATTCTCATACACTGCTGG - Intronic
1122833404 14:104416589-104416611 CTGGAACTCTCACACACTGCTGG + Intergenic
1124016664 15:25882813-25882835 CTGGAACTCTCAGGCATTGCAGG + Intergenic
1124113325 15:26814111-26814133 CAGAAACTCTCATTCATTGCTGG + Intronic
1125082278 15:35689026-35689048 CTGGAACTCTCATACACTGCTGG - Intergenic
1125119760 15:36140941-36140963 CTGGAACTCTCATACGTGTCTGG - Intergenic
1125176159 15:36824534-36824556 CTGGAACTCTCATACATAGCTGG + Intergenic
1125742483 15:41975758-41975780 CTGGAACTCTTACACATTGTTGG + Intergenic
1125978562 15:43978363-43978385 CTAGAACTCTCATACATTGCTGG + Intronic
1125987440 15:44068117-44068139 CTGGAACTCTCACATATTGCTGG + Intronic
1126019360 15:44385291-44385313 TTGGAACTCTTATACGTTGCTGG - Intronic
1126801214 15:52298694-52298716 CTAAAAGTCTCACACACTGCTGG - Intergenic
1127100912 15:55563933-55563955 CTGGAACCCTCATACTTTGCAGG + Intronic
1127105509 15:55609541-55609563 TTAAAACCCTCATACGTTGCTGG - Intergenic
1128140039 15:65292929-65292951 CTGAAACTCTTATACATTGATGG + Intronic
1128844421 15:70877783-70877805 CTGGAACTCTCCTACATTGCTGG - Intronic
1128888359 15:71308854-71308876 TTGGAACCCTCATACGTTGCTGG - Intronic
1129134856 15:73539076-73539098 CTGGCACTCACACACATTGCTGG - Intronic
1129506472 15:76085594-76085616 CAGAAACTCTCACACATGGCTGG + Intronic
1129534592 15:76302061-76302083 CAGAAACTCTCATTCATTGCTGG + Intronic
1129563814 15:76599288-76599310 CAGGAACTCTCACACATTGTTGG + Intronic
1129919097 15:79303633-79303655 CTGGAACTCTCATACACTGCTGG - Intergenic
1129996580 15:80011647-80011669 CTGGAACTCTCATACACTGCTGG + Intergenic
1130002021 15:80056106-80056128 CTGAAACTCTCACTCATTGCTGG + Intergenic
1130057498 15:80540270-80540292 CTGGAACACTCACACACTGCTGG - Intronic
1130369289 15:83270447-83270469 TTGGAACCCTCATACGTTGCTGG - Intronic
1130776125 15:86985352-86985374 CTGAAATTCTCATACATTGCTGG - Intronic
1130840141 15:87691697-87691719 TTGGAACCCTCATACGTTGCTGG + Intergenic
1130840555 15:87696365-87696387 CTGAAACTCTCATACATTGCTGG - Intergenic
1131163009 15:90121146-90121168 CTGAAACTCTCATACTTTGCTGG - Intergenic
1131506393 15:93023611-93023633 CTTCAACTCTTACACATTGCTGG - Intronic
1131743968 15:95424877-95424899 CTGGAGCTCTCATACATTGCTGG - Intergenic
1131895496 15:97024503-97024525 TTGGAACTCTCATACATTGCTGG + Intergenic
1131942225 15:97579725-97579747 CTGGAACTCTCACACATTGCTGG - Intergenic
1132257509 15:100389346-100389368 CAGGAACTCTCATCCGTTGCCGG + Intergenic
1132270816 15:100522943-100522965 CTGGAACTCTCATACGTCACTGG - Intronic
1132596938 16:756480-756502 CTGGAACTCTCAGAGGCTGCTGG - Intronic
1133353407 16:5117990-5118012 CTCAAAGTCACACAGGTTGCAGG - Intergenic
1133518983 16:6538617-6538639 CTGAAATTCTCAAATATTGCTGG + Intronic
1133670964 16:8019828-8019850 CTGAAACTCTCACACATTGCTGG + Intergenic
1134105509 16:11483185-11483207 CTGAAACTCTCACACAATGCTGG + Intronic
1134122285 16:11593418-11593440 TTGAAACCCTCAAACATTGCTGG + Intronic
1134168116 16:11946667-11946689 CAGAAACTCTCCCACATTGCCGG + Intronic
1134542285 16:15077307-15077329 CTGTAAGTCACACATGTTGCTGG + Intronic
1134647339 16:15880269-15880291 CTGGAACTTTCACACTTTGCTGG + Intronic
1134899486 16:17924128-17924150 CTGGAACTCACATACATTGCTGG + Intergenic
1135527454 16:23224906-23224928 TTGAATCTCTTTCACGTTGCTGG - Intergenic
1135530627 16:23250149-23250171 CTGGAACTCTCAGACTCTGCTGG - Intergenic
1137238481 16:46634451-46634473 CTGGATCGCTCAAACGTTGCTGG + Intergenic
1137282991 16:46993689-46993711 CTAGAACTCTCATACATTGCTGG + Intergenic
1137994216 16:53191878-53191900 CTGGAACTCTCATACACTGCTGG - Intronic
1138139417 16:54555182-54555204 CTGGAACTCTCATACGTTGTTGG + Intergenic
1138253147 16:55523332-55523354 CAGGAACTCTCATACCTTGCTGG + Intronic
1138703222 16:58886948-58886970 CTGAAACTCTCAAATACTGCTGG + Intergenic
1139027858 16:62841195-62841217 ATGAAACTTTCATACATTGCTGG - Intergenic
1141737696 16:85865131-85865153 CTGAAACTCTCAGATGTTGATGG - Intergenic
1142819111 17:2450006-2450028 CGGAAACTCTCAGATATTGCTGG + Intronic
1143232173 17:5366102-5366124 CAGGAACTCTCATACATTGCTGG - Intronic
1143691808 17:8573929-8573951 CTGGAACTCTCACATGTTCCTGG + Intronic
1144035808 17:11364813-11364835 CTGGAACTCTCATACACTGCTGG - Intronic
1144159180 17:12540696-12540718 CTGAGACTCTCATACATTACTGG - Intergenic
1144603614 17:16643050-16643072 CTGCAACACTCATACGTTGCTGG + Intronic
1144694525 17:17293212-17293234 CTGGAACTCTCACACACAGCTGG - Intergenic
1145094455 17:20013317-20013339 CTGAAATTCTCACGCATTGCTGG - Intronic
1145101831 17:20083841-20083863 CTGGAACTCTAATACATTGCTGG - Intronic
1145109200 17:20146973-20146995 CAGAAACTCTCATTCATTGCTGG - Intronic
1145187502 17:20807713-20807735 TTGAAACACTCATATGTTGCTGG - Intergenic
1145766225 17:27459955-27459977 CTCAAACTCACACACGTTCCTGG + Intronic
1145871682 17:28278823-28278845 CTGAAACTCTCATACCCAGCTGG + Intergenic
1146120339 17:30188486-30188508 CTGGAACTCTCATACATTGATGG - Intergenic
1146153762 17:30501417-30501439 CAGGAACTCTCACTCATTGCTGG + Intronic
1146435034 17:32837001-32837023 CTGGAACTCTTACACATTGCTGG - Intronic
1146690298 17:34869888-34869910 CTGAAACTCTCAAACATTGTTGG - Intergenic
1146752279 17:35392241-35392263 CAGAAACTCTCACTCATTGCTGG - Intergenic
1146851486 17:36225690-36225712 TTGAAACACTCATATGTTGCTGG + Intronic
1146867393 17:36349563-36349585 TTGAAACACTCATATGTTGCTGG + Intronic
1147070270 17:37950174-37950196 TTGAAACACTCATATGTTGCTGG + Intergenic
1147081794 17:38029700-38029722 TTGAAACACTCACATGTTGCTGG + Intronic
1147097742 17:38153670-38153692 TTGAAACACTCATATGTTGCTGG + Intergenic
1147534814 17:41313132-41313154 CTGGAACTCTCAGACATTGCTGG + Intergenic
1147972780 17:44228610-44228632 CTCAAACTCTCTCACTTAGCTGG + Intergenic
1148893079 17:50821669-50821691 CTGAAAGTCTCACAGGAGGCTGG - Intergenic
1149038924 17:52164042-52164064 CTGGAACTCTCATGCATTGCTGG + Intergenic
1149109086 17:53005061-53005083 TTGAAACTCTCTCAGGTTGCAGG - Intergenic
1150079439 17:62223796-62223818 TTGAAACACTCATATGTTGCTGG + Intergenic
1150200113 17:63346642-63346664 CTGGAACTCTAATACATTGCTGG + Intronic
1150204591 17:63393095-63393117 GAGAAACTCTCACAGGTTGGAGG - Intronic
1150451810 17:65275447-65275469 TTGAAACTCTCACGCATTGCTGG + Intergenic
1150516986 17:65823972-65823994 CTGGAACTCTCATACACTGCTGG + Intronic
1150548179 17:66184622-66184644 CAGAAACTCTCATGCATTGCTGG + Intronic
1150627784 17:66853459-66853481 CTGCAGCTCTCATATGTTGCTGG - Intronic
1150845264 17:68650636-68650658 CTGGAACTCTTACACACTGCTGG + Intergenic
1151174837 17:72279058-72279080 TTGAAACTCTCATACGTTGCTGG - Intergenic
1151205682 17:72504872-72504894 CTGGAACTCTCAGACATTGCTGG + Intergenic
1151582120 17:74986052-74986074 CTGGAACTCTCTCACCCTGCTGG - Intergenic
1151862278 17:76773342-76773364 CGGAATCACTCACACATTGCTGG - Intronic
1152922935 17:83074747-83074769 CTGAAACTCACAAACGTTGAAGG - Intergenic
1153031340 18:715894-715916 CTGGAACTCTCATACATTGCTGG + Intergenic
1153177248 18:2391165-2391187 CTGAAACTCTCATACATTGCTGG + Intergenic
1153628750 18:7048364-7048386 CCAGAACTCTCACACATTGCTGG + Intronic
1153669567 18:7397853-7397875 CTGGATCTCTCACTCATTGCTGG - Intergenic
1153858802 18:9177332-9177354 CTGGAACTCTCATATGTGGCTGG - Intronic
1153928072 18:9852846-9852868 CTGGAACTCCCACACATTGGTGG - Intronic
1154099283 18:11454895-11454917 CTGAAACTCTAACATATTCCAGG + Intergenic
1154495214 18:14951476-14951498 TTGAAACCCTCCCACATTGCAGG - Intergenic
1154947349 18:21175507-21175529 CTGGAACTCTCATGCATTGCTGG + Intergenic
1155182525 18:23360176-23360198 CTGGAACTCTCACATACTGCTGG + Intronic
1155363345 18:25025846-25025868 CTGAAATTCTCACATGCTGTTGG - Intergenic
1155598686 18:27517711-27517733 CAGAGACTCTCAAACATTGCTGG - Intergenic
1155871497 18:31034408-31034430 CTGAAACCCCTACACTTTGCTGG + Intronic
1155985463 18:32226349-32226371 TTGGAACTCTCACACATTGATGG - Intronic
1156077305 18:33295805-33295827 CTGGATCTCTCATACATTGCTGG + Intronic
1156265595 18:35485571-35485593 CTGGAACCCTCATACATTGCTGG + Intronic
1156266766 18:35496040-35496062 CTGGCACTCTCATACTTTGCCGG + Intronic
1156274206 18:35566744-35566766 CTTAAATTCTCACACATTGCTGG + Intergenic
1157124225 18:44939668-44939690 CTGACACTATCATACGTTGTTGG - Intronic
1157708622 18:49831635-49831657 CTGGAACTCTCATGCATTGCTGG + Intronic
1157825904 18:50812122-50812144 TTGGAACCCTCATACGTTGCTGG - Intronic
1158781321 18:60655726-60655748 TTGTAACTCTCACATGCTGCTGG + Intergenic
1158919157 18:62169992-62170014 CTGAAACTCTCATATATTGCTGG - Intronic
1159571171 18:70113409-70113431 ATGAAACACTCATACATTGCTGG + Intronic
1159874451 18:73794719-73794741 CAGAAACTCTCATTCATTGCTGG + Intergenic
1160082260 18:75739515-75739537 CTGAAATTCTCATTCGTTGCTGG + Intergenic
1160598121 18:79991715-79991737 CTGAAACCCTCACACATTCCTGG - Intronic
1161724672 19:5921601-5921623 CTGGAACCCTCACACACTGCTGG + Intronic
1161775229 19:6258013-6258035 CAGGAACCCTCACACATTGCTGG + Intronic
1164149571 19:22539580-22539602 CTGGAACACTCATACATTGCTGG + Intergenic
1164815637 19:31200094-31200116 CAGAAACTCTCACTCATTGCTGG + Intergenic
1165540245 19:36487224-36487246 CTGGAACTCTCATACATTGCTGG + Intronic
1166519538 19:43471236-43471258 CTGAAACTCTCCCACACAGCTGG - Intergenic
1167678617 19:50905684-50905706 CTGTAACTCTCCTACATTGCTGG - Intergenic
1168593791 19:57657500-57657522 CTGGAGCTCTCATACATTGCTGG + Intergenic
925214273 2:2080727-2080749 CTGGAACTCTCATACATTGCAGG + Intronic
925630551 2:5888578-5888600 TTGACACCCGCACACGTTGCTGG + Intergenic
926115704 2:10211889-10211911 CTGCAACTCTCATATGCTGCAGG + Intergenic
926415594 2:12646510-12646532 CTTGAATTCCCACACGTTGCGGG - Intergenic
926713877 2:15908460-15908482 CTGGAACTCTCACTCACTGCTGG + Intergenic
926872378 2:17436609-17436631 CTGGAACTCACAAACATTGCTGG + Intergenic
926947787 2:18206811-18206833 TAGAAACTCTCATTCGTTGCTGG - Intronic
927034060 2:19154350-19154372 CAGAAACTCTCATTCATTGCTGG + Intergenic
928049546 2:27976086-27976108 CTGGAACTCTCATGCGTTGTTGG + Intronic
928323057 2:30298830-30298852 CTGGAACTCTCATACATTGGTGG - Intronic
928709843 2:33991479-33991501 CAGTGACTCTCACACATTGCTGG - Intergenic
928935699 2:36675547-36675569 TTGGAACTCTCACACATTGCAGG + Intergenic
929042146 2:37755291-37755313 CTGGAACTCTCATACATTGCTGG + Intergenic
929392465 2:41486186-41486208 CTGGGACTCTCATACATTGCTGG + Intergenic
929481160 2:42309513-42309535 CTGAAACCCTCATACATTGCTGG - Intronic
929743125 2:44625110-44625132 CTGAAACTCTCATACACTGCTGG - Intronic
929831099 2:45347052-45347074 TTGGAACTCTCACACGTTGATGG + Intergenic
929853739 2:45617337-45617359 CTGGAACTCTCACGCATTTCTGG - Intergenic
930396902 2:50833206-50833228 CTAGAACTCTAACACATTGCTGG + Intronic
930436453 2:51350154-51350176 CTGGAACTCTCATACATTTCTGG + Intergenic
930450381 2:51528432-51528454 TTGGAACCCTCACACATTGCTGG - Intergenic
930467749 2:51775557-51775579 TTGAAATTCTCATACATTGCTGG + Intergenic
931170139 2:59794431-59794453 CTGGAACTCTCATACATTCCTGG + Intergenic
931215416 2:60237763-60237785 CTGGAACTCTCATAAGCTGCTGG - Intergenic
931331581 2:61291321-61291343 CTGGAACCCTCACACATTGCTGG + Intronic
931440192 2:62284709-62284731 CTGGAATTCTCATACATTGCTGG + Intergenic
931490255 2:62737696-62737718 CTGGAACCCTCATACATTGCTGG - Intronic
931641868 2:64387728-64387750 CTGAATCTCTCTTACATTGCTGG - Intergenic
931718786 2:65051686-65051708 CTGGAACTCTCATACATGGCTGG - Intergenic
931782740 2:65592854-65592876 CTGGAACTCTCATACATTGCTGG - Intergenic
932035014 2:68235810-68235832 CTGGAACCCTCAAACCTTGCTGG - Intronic
932052774 2:68415706-68415728 TTGAAACTCTCATACACTGCTGG + Intergenic
932154252 2:69401716-69401738 CAGAAACTCTCATACACTGCTGG - Intronic
932187435 2:69710827-69710849 CTGGAATTCTCATACATTGCTGG + Intronic
932323164 2:70836752-70836774 TTGAAAATCTCACATGGTGCAGG - Intergenic
932491386 2:72124818-72124840 CTGGATCTCTCATACATTGCTGG + Intergenic
932654332 2:73595748-73595770 CCGAAACCCTCACACATTGCAGG - Intronic
932843918 2:75115366-75115388 CAGGAACTCTCACACATTGCAGG + Intronic
932868955 2:75377128-75377150 CTGGAACTCTCATACATTGTTGG + Intergenic
933445250 2:82371597-82371619 TTCAAACTCTCACACGTTGCAGG - Intergenic
933848087 2:86341991-86342013 CTGGAACTCTCATATGCTGCTGG + Intergenic
933929659 2:87136290-87136312 CCGAAACTCTCATACATTACTGG + Intergenic
933982258 2:87560664-87560686 CTGGAACTCTTATATGTTGCTGG + Intergenic
934000991 2:87712081-87712103 CCGAAACTCTCATACATTACTGG + Intergenic
934092029 2:88560064-88560086 TTGGAACCCTCATACGTTGCTGG - Intronic
934721827 2:96583834-96583856 CTGGAACTCTTAGACATTGCTGG - Intergenic
934849117 2:97685919-97685941 TTGAAACCCTCATACATTGCTGG + Intergenic
934879494 2:97962592-97962614 CTGGAACTCTCACATCCTGCTGG + Intronic
935001612 2:99022801-99022823 GTGAAACCCTCATACATTGCTGG - Intronic
935551185 2:104457094-104457116 CTGGAACACTCATACATTGCTGG - Intergenic
935643786 2:105315729-105315751 CTGGAAATCTCATACGTTGCTGG + Intronic
935805132 2:106738240-106738262 CTGAAACCTTCAGACATTGCTGG - Intergenic
935928588 2:108098160-108098182 TTGAAACTCTCATATATTGCTGG + Intergenic
936118057 2:109718098-109718120 CTGGAACCCTCACATATTGCTGG + Intergenic
936143485 2:109961799-109961821 CTGGAACTCTCATACGTTGCTGG - Intergenic
936180171 2:110259762-110259784 CTGGAACTCTCATACGTTGCTGG - Intergenic
936201202 2:110409667-110409689 CTGGAACTCTCATACGTTGCTGG + Intronic
936248676 2:110850694-110850716 CTGCAACTCTGATACATTGCTGG + Intronic
936311580 2:111390146-111390168 CTGGAACTCTTATATGTTGCTGG - Intergenic
936580857 2:113699346-113699368 CTGAGACACTCATACATTGCTGG + Intergenic
936712345 2:115145764-115145786 CTGAAACTCTCATTCATTGCTGG - Intronic
936927012 2:117747511-117747533 CAGAAACTGTTACAAGTTGCGGG - Intergenic
937149549 2:119676635-119676657 CTGAAACCCTCATACATTGCTGG - Intergenic
937392215 2:121498946-121498968 TGGAAACTCTTACAGGTTGCTGG + Intronic
937709418 2:124962080-124962102 CTGGATCTGTCACACATTGCTGG + Intergenic
937794594 2:126001905-126001927 CTGGAATTCTCACACACTGCTGG - Intergenic
937892694 2:126950850-126950872 CTGGAAATCTCACACATTGCTGG - Intergenic
938121038 2:128633879-128633901 CTGAAACTCTCATCCATTGCTGG - Intergenic
938155018 2:128928916-128928938 CAGAAACTGTCATTCGTTGCTGG - Intergenic
938768019 2:134475861-134475883 CTGGAACTCTCATATGTTGCTGG + Intronic
938892280 2:135717722-135717744 CTAAAATTCTCACACATTGGCGG + Intronic
939797091 2:146658719-146658741 TTGGAACTCTCACACATTGCTGG + Intergenic
940370091 2:152891628-152891650 TTGGAACCCTCATACGTTGCTGG + Intergenic
940606610 2:155932016-155932038 CTGGAACACTCACGCATTGCTGG + Intergenic
940620539 2:156107503-156107525 ATGAAACTCTCAAATGCTGCTGG + Intergenic
940749151 2:157604689-157604711 CTGGAACTCTCATACATTACTGG - Intronic
940832847 2:158487424-158487446 CTGAATTACTCACAAGTTGCAGG - Intronic
940863530 2:158794105-158794127 CTGAAACTCTCATACATTGCTGG - Intergenic
941104618 2:161339255-161339277 CGGGAACTCTCACACACTGCTGG - Intronic
941258583 2:163266970-163266992 CTGGAATTCTCACATATTGCTGG - Intergenic
941970445 2:171344771-171344793 CAGAAGCTCTCACACATTACTGG - Intronic
942160544 2:173181412-173181434 CTGAAACCCTCATACGTTGCTGG + Intronic
942178930 2:173361386-173361408 CTGTAACCCTCACACACTGCTGG - Intronic
942347226 2:175016004-175016026 ATAAAACTCTCACAAGTTTCAGG - Intergenic
942355453 2:175107305-175107327 CTGGAATTCCCACACGCTGCTGG + Intronic
942423120 2:175829030-175829052 CTGGAACACTCATACATTGCTGG + Intergenic
942443356 2:176059219-176059241 CTGAAACCCTTGCACATTGCTGG + Intergenic
942526960 2:176863205-176863227 CTGTAACTCTCATACACTGCTGG - Intergenic
942550439 2:177110496-177110518 TTGGAACCCTCACACATTGCTGG + Intergenic
943170911 2:184397932-184397954 TTGAAACCCTCATACATTGCTGG - Intergenic
944162621 2:196680836-196680858 CTGGAACTCTCAAACATTGCTGG - Intronic
944334343 2:198513068-198513090 CTGAAACTCTCACATATTGTTGG - Intronic
944387024 2:199178797-199178819 CTGATACTCTAATATGTTGCAGG + Intergenic
944662722 2:201934536-201934558 CAGTAACACTCACACGTTCCAGG - Intergenic
944758851 2:202792222-202792244 CTAGAACCCTCACACTTTGCTGG + Intronic
944782859 2:203038323-203038345 CTGTAACTCTCATACATTACTGG - Intronic
944949729 2:204734291-204734313 CTTGAACTCTCATACATTGCTGG + Intronic
945103257 2:206283320-206283342 CTGGAACCCTCATACATTGCTGG - Intronic
945415868 2:209571525-209571547 CTAAGACTCTCATACATTGCTGG - Intronic
946204167 2:218091448-218091470 CAGAAACTCTCACATGCTGCTGG - Intergenic
946209561 2:218136457-218136479 CTGGAACTCTCGAGCGTTGCTGG + Exonic
946371047 2:219281610-219281632 CTGACACTCTGACACTTGGCGGG - Intronic
946669479 2:222087131-222087153 CTCAAACACTCATACATTGCTGG + Intergenic
946771948 2:223098004-223098026 CTGGCACACTCACACATTGCTGG + Intronic
946862828 2:224016151-224016173 CTGGATCACTCACACATTGCTGG + Intronic
947522583 2:230859635-230859657 CTGAAACTCTCATACATTGCTGG + Intergenic
948011274 2:234651207-234651229 CTGCATCACTCACACATTGCTGG - Intergenic
948161935 2:235831926-235831948 CAGAAACTCTCATCCATTGCTGG - Intronic
948362323 2:237431628-237431650 CTGGAACTCCCACACACTGCTGG + Intergenic
948497365 2:238360528-238360550 CTGAAACTCTTATACACTGCTGG - Intronic
1168867432 20:1099874-1099896 TTGGAACTCTCATATGTTGCTGG - Intergenic
1168985044 20:2040653-2040675 CTGAAACTCTCATATGCTGCTGG + Intergenic
1169031703 20:2414438-2414460 TTGAAACACTCATACATTGCTGG + Intronic
1169295243 20:4391174-4391196 CTGGATCTCTCATACGTTGCTGG + Intergenic
1169307970 20:4509993-4510015 CTAGAACTCTCATACGTTGCTGG - Intergenic
1169891278 20:10454858-10454880 CTGGAACTCTCATACATTGATGG - Intronic
1169905363 20:10597806-10597828 CTGGAATTCTCATACGCTGCTGG - Intronic
1170079128 20:12451533-12451555 CTTGAATTCTCACACGTTGTGGG + Intergenic
1170128764 20:12995794-12995816 ATGGAACTCTCATACTTTGCAGG + Intergenic
1170234914 20:14092053-14092075 CTGAACCTATCACACATTGCTGG - Intronic
1170369124 20:15629220-15629242 CTGAAATTCTCATACACTGCTGG - Intronic
1170487447 20:16833234-16833256 CTGGAACTCTTATACATTGCTGG - Intergenic
1170930267 20:20763250-20763272 CTGAAACTCTCAAGCACTGCAGG + Intergenic
1171024715 20:21619298-21619320 CTGGAACTCTCAGAAATTGCTGG - Intergenic
1171151723 20:22833441-22833463 CAGAAACTCTCATTCATTGCTGG + Intergenic
1171358678 20:24570678-24570700 CTGGAACTCTCATACATTGCCGG + Intronic
1172040009 20:32037299-32037321 CAGACACTCTCACACATTCCTGG + Intergenic
1172171879 20:32940932-32940954 CTGGGACTCTTACACATTGCTGG + Intronic
1172218745 20:33257275-33257297 GTGAAACTCTCATACATTCCTGG + Intergenic
1172747057 20:37219134-37219156 TTGGAACCCTCACACATTGCTGG - Intronic
1172784977 20:37462381-37462403 CTGAAACTCTCATACATTGCTGG - Intergenic
1172785680 20:37466822-37466844 CTGGAACTCTCATAGGTTGCTGG + Intergenic
1172965636 20:38832548-38832570 CTGGATCACTCACACATTGCTGG + Intronic
1172988850 20:39016637-39016659 CTGGAACTCTCATACATTGCTGG - Intronic
1173376804 20:42492303-42492325 CTGGATCTCTCCTACGTTGCTGG - Intronic
1173893960 20:46536025-46536047 CTGGAACCCTCACACACTGCTGG + Intergenic
1174408028 20:50315070-50315092 CTGACACTTTCATACATTGCTGG - Intergenic
1174592272 20:51655657-51655679 CGGAAACTGTCATACGTTGCTGG + Intronic
1175376291 20:58526659-58526681 CTGGAACTCTCGTACATTGCTGG - Intergenic
1175406775 20:58739711-58739733 CTGGAACTCTCAGACATTGCTGG + Intergenic
1175548059 20:59792435-59792457 CTGAAACTCTAATACCTTGATGG - Intronic
1175587376 20:60152779-60152801 TAGAAACTCTCATATGTTGCTGG - Intergenic
1175969688 20:62678350-62678372 CTGGAACACTCACCCGTCGCCGG + Intronic
1176687848 21:9868558-9868580 CTGGAACTCTCATACCTTGATGG - Intergenic
1176948953 21:15020930-15020952 CTGAAACTCTCCTCCATTGCTGG + Intronic
1176985191 21:15427834-15427856 TTGAAACCCTCACACATTGCTGG - Intergenic
1178071711 21:28975748-28975770 CTAAAAATCTCACACATTGCTGG + Intronic
1178514974 21:33239024-33239046 CGAAAATTCTCACACATTGCAGG + Intronic
1179155200 21:38844199-38844221 CTGGAACTCTTACATGTAGCTGG - Intergenic
1179282740 21:39948664-39948686 CTAAAAATCTCATGCGTTGCTGG - Intergenic
1180115330 21:45699836-45699858 CCGAAACTCCCACATGTTGTGGG - Intronic
1180845219 22:18977294-18977316 CTGGAACTCTCATACGCTGTTGG + Intergenic
1180882204 22:19213349-19213371 CTGGAACTCTCACATATTGCTGG + Intronic
1180895311 22:19327483-19327505 CTGGAACTCTCATGCATTGCTGG - Intergenic
1182035016 22:27191385-27191407 CTGGAACTCTCATACATTGTTGG + Intergenic
1182179096 22:28325873-28325895 CTGAAACTCTTATATATTGCTGG + Intronic
1182876554 22:33696611-33696633 CTGTATCTCTCACACATTACTGG - Intronic
1184083595 22:42243940-42243962 CTGGAACCCTCACATATTGCTGG + Intronic
1184534755 22:45078582-45078604 CTGGGACTCTCACACACTGCTGG + Intergenic
1184863012 22:47187123-47187145 CAGGAACTCTCACTCATTGCTGG + Intergenic
1185256664 22:49837348-49837370 CTGGAACTCTCTCATGCTGCTGG + Intergenic
1203294350 22_KI270736v1_random:26793-26815 CTGGAACTCTCATACATTGCTGG + Intergenic
949194956 3:1293986-1294008 CTGGAACTCTCAAATATTGCTGG + Intronic
949492409 3:4602065-4602087 TGGCAACTCTCACACATTGCTGG + Intronic
949688405 3:6605312-6605334 CTGGATCTCTCGCACATTGCTGG - Intergenic
949996987 3:9625903-9625925 CTGGAACTCTCACACGCTGCTGG - Intergenic
950135541 3:10578190-10578212 CAGAGGCTCTCATACGTTGCTGG + Intronic
950257336 3:11516473-11516495 CAGAAACTCTCATTCATTGCTGG + Intronic
950344945 3:12285365-12285387 CTGGAACCCTGACACATTGCTGG + Intergenic
950448554 3:13052659-13052681 CTGGATCACTCACCCGTTGCTGG - Intronic
950678981 3:14571931-14571953 CTGGAACTCTCAGACGCTGCTGG + Intergenic
950688721 3:14638486-14638508 TTGGAACTCTCATACATTGCTGG - Intergenic
950727866 3:14929457-14929479 CTCAAATTCACACACGTTGTTGG - Intronic
950865577 3:16186315-16186337 TTGGAACCCTCACACATTGCTGG + Intronic
951150280 3:19280684-19280706 CTTAAACTCTCATACATTGCTGG - Intronic
951154492 3:19332962-19332984 CTGGATCTCTCACACATTGCTGG - Intronic
951367334 3:21799380-21799402 CTGGAACGCTTACACATTGCTGG - Intronic
951823627 3:26842645-26842667 CTGAAACTCTCAAACCTTTTAGG + Intergenic
952038214 3:29230324-29230346 CAGAAACTTTCATACATTGCTGG - Intergenic
952181349 3:30919750-30919772 ACGATACTCTCACACATTGCTGG + Intergenic
952288662 3:31993746-31993768 TTGGAACTCTTACACATTGCTGG + Intronic
952438318 3:33295699-33295721 CTGGAACTCTCATACACTGCTGG - Intronic
952476899 3:33719210-33719232 CTGGAACTCTCAAGCATTGCTGG - Intergenic
952767214 3:36964408-36964430 CTGGAACTCTCACATTTTGCTGG - Intergenic
952847257 3:37698790-37698812 CTCAAACTCTTATACATTGCTGG - Intronic
953085418 3:39661232-39661254 CTGGAACTCTCATACTTTGCAGG + Intergenic
953110281 3:39930168-39930190 CTGGAACCCTCATACATTGCTGG - Intronic
953504140 3:43467119-43467141 CTGGAACTCTCAATCATTGCTGG + Intronic
953756296 3:45648687-45648709 CTGGAACTCTCATACATGGCTGG - Intronic
953869229 3:46611942-46611964 TTGGAACTCTCACACATTGCTGG - Intronic
954494439 3:50941439-50941461 CTGCATCTCTCATACATTGCTGG + Intronic
954568173 3:51617338-51617360 CTGGAACTCTCATACACTGCTGG - Intronic
955183000 3:56689348-56689370 CAGAAACTCTCTCCTGTTGCTGG + Intergenic
956042531 3:65159606-65159628 TTGGAACTCTCATACATTGCTGG - Intergenic
956085871 3:65608662-65608684 CTGGAACTCTTACACGGTGTAGG + Intronic
956130643 3:66050549-66050571 TTGAAACCCTCATACATTGCTGG + Intergenic
956330915 3:68106956-68106978 CTGAAACTCTCATACATTGTTGG + Intronic
956385772 3:68717467-68717489 CTGGATCTCTCACACATTGCAGG + Intergenic
956399716 3:68864473-68864495 CTGAAACTCTCATTCACTGCTGG + Intronic
956416647 3:69037932-69037954 CTGAAACCCTCACCTATTGCTGG + Intronic
956548307 3:70432158-70432180 CTGGAACTCTCATACATTGCTGG - Intergenic
957532533 3:81459187-81459209 CTGGAACACTCACACATAGCTGG + Intergenic
958059041 3:88454048-88454070 TTGAAACTCTCATACACTGCTGG - Intergenic
958789469 3:98634527-98634549 CTGAAGCTTTCACACATTGTTGG + Intergenic
959336739 3:105076747-105076769 CTTGAACTCTCATACATTGCTGG + Intergenic
959845545 3:111028404-111028426 CAGGTACTCTCACACGTTGTTGG + Intergenic
960112915 3:113862964-113862986 TTAAAACTCTCATACATTGCTGG + Intronic
960258902 3:115542617-115542639 CAGACACTCTCATACATTGCAGG - Intergenic
960493269 3:118344392-118344414 CTGGAACTCTCATACGCTACTGG - Intergenic
960923743 3:122775665-122775687 CTGGAACTCTCATACATTGAAGG + Intronic
961015214 3:123462816-123462838 CTGGAACTCTCATACACTGCTGG + Intergenic
961505246 3:127366616-127366638 CTGGAACTCTCGCACCCTGCTGG + Intergenic
961661644 3:128471906-128471928 CTGAAATTCCCACACCCTGCTGG + Intergenic
962000623 3:131291566-131291588 CAGGAACTCTCACTCATTGCTGG - Intronic
962557511 3:136570662-136570684 CTGAAAATCTCACATCTTGCTGG - Intronic
962815226 3:138991677-138991699 TTGTAACTCTCACACATTGCTGG - Intergenic
962915417 3:139897821-139897843 CTGCAACTCTCAGACATTGCTGG - Intergenic
963135097 3:141895835-141895857 CTGAAACTCTCACATCCTGCTGG - Intronic
963226252 3:142865096-142865118 TTGAAACTCTCATACACTGCTGG - Intronic
963821911 3:149906451-149906473 CTGGAACCCTCATACATTGCTGG - Intronic
964180597 3:153879671-153879693 CTGGAACTCTCATACATTGCTGG + Intergenic
964274379 3:154993453-154993475 AGGAAACTCTTACACGCTGCTGG + Intergenic
964642325 3:158922295-158922317 CTGAAACTCTCATACACTTCTGG - Intergenic
965029608 3:163348138-163348160 CAGGAACTCTCATTCGTTGCTGG + Intergenic
965430904 3:168587113-168587135 ATGAAACTCTCACATATTGTTGG - Intergenic
965699157 3:171441765-171441787 CTGGAACTCTCATACATTGCCGG - Intronic
965724979 3:171705725-171705747 TTGAAACTCTCATACATTGCTGG + Intronic
965753789 3:172004872-172004894 CTGGAAATCTCATACATTGCCGG + Intergenic
966065578 3:175817450-175817472 CCAAAACTCTCACACATTGTTGG + Intergenic
966128820 3:176611526-176611548 CTGGAACTCTCACACATTGCTGG + Intergenic
966654290 3:182337203-182337225 CAGGAACTCTCATACATTGCTGG + Intergenic
967075571 3:185999140-185999162 CTGGCACTCTCACACATTGCTGG - Intergenic
967205388 3:187114933-187114955 CTGAAATTCTCATACATTGCTGG - Intergenic
967626887 3:191697013-191697035 CTGAAACTCTCGTACATTCCTGG - Intergenic
967649719 3:191972350-191972372 TTGGAACTCTCAAACATTGCTGG + Intergenic
967665999 3:192172667-192172689 CTGCAACTCACATACATTGCTGG + Intronic
968151531 3:196340531-196340553 CTGGAACTGTCACACACTGCTGG - Intergenic
968840451 4:3000955-3000977 CTGAAACACACACACCCTGCTGG - Intronic
969062254 4:4446674-4446696 CTGTAACTTTCATACATTGCTGG + Intronic
970129815 4:12855088-12855110 CTGGAACTCTCATACAATGCTGG - Intergenic
970147298 4:13049975-13049997 CTGGAACTCTCACACATGGTTGG + Intergenic
970255545 4:14165774-14165796 CTGAAGCTCTCACATGCTTCTGG - Intergenic
970604022 4:17662755-17662777 CTGAAACTCTCATACATTGCTGG - Intronic
970845334 4:20531012-20531034 TTGAAACCCTCATACATTGCTGG + Intronic
971088515 4:23310491-23310513 CTGAAATACTCACAAGTTTCTGG - Intergenic
971275179 4:25189487-25189509 CTGGAATTCTCAGACGTCGCTGG - Intronic
971300552 4:25438927-25438949 CTGAAACACTCAGACATTGCTGG - Intergenic
971535332 4:27740725-27740747 CAGAAACTCTCATACGCTGTTGG - Intergenic
971961572 4:33494384-33494406 CTGGAACTCTCATATGCTGCTGG - Intergenic
972038901 4:34564771-34564793 CTGAAACTCTCAACCATTGCTGG + Intergenic
972059348 4:34849513-34849535 CTGAAACTTTCACATATTCCTGG - Intergenic
972069751 4:35002771-35002793 CTGGAACCCTCATACATTGCTGG - Intergenic
972074616 4:35070415-35070437 CAGGAACTCTCACTCGTTGGTGG + Intergenic
972141174 4:35961326-35961348 CTGGAACTCTCACTCATTGCTGG - Intronic
972198466 4:36682765-36682787 ATGGAACACTCACACATTGCTGG - Intergenic
972210144 4:36826708-36826730 CTTGAATTCTCACACGTTGTGGG + Intergenic
972433214 4:39004761-39004783 CTGAAACTCTCATACATTGCTGG + Intronic
972761390 4:42108424-42108446 TTGAAACCCTCAAACATTGCTGG - Intergenic
972784360 4:42313325-42313347 CGGGATCTCTCACACATTGCTGG - Intergenic
972923092 4:43967875-43967897 CTGAAACTTTCATACATAGCTGG - Intergenic
972989586 4:44807773-44807795 CAGAAACTATCACACAATGCTGG - Intergenic
973029653 4:45320738-45320760 CCGCAACTCTCATACATTGCTGG - Intergenic
973677183 4:53276783-53276805 CTAAAACTCTCATATGTTGCTGG - Intronic
973977616 4:56279019-56279041 TTGGAACCCTCACACATTGCTGG + Intronic
974048418 4:56916972-56916994 TTGGAACCCTCACACATTGCTGG - Intronic
974377401 4:61095920-61095942 CAGAAACTCTCATTCATTGCTGG + Intergenic
974468577 4:62290465-62290487 CTGGATCTGTCACACATTGCTGG - Intergenic
974833563 4:67218728-67218750 CTGGAACCCTCACACGTTGCTGG - Intergenic
974970218 4:68814875-68814897 CTGAAACTCTCATACATTGTTGG + Intergenic
974985578 4:69021487-69021509 CTGAAACCCTCAAACATTGTTGG - Intronic
975167496 4:71193558-71193580 ATGATACTCTCACACAATGCTGG - Intronic
975225854 4:71871023-71871045 CTGAATCACTCACATATTGCTGG - Intergenic
975274618 4:72482028-72482050 CTGGAACATTCATACGTTGCTGG + Intronic
975638386 4:76473842-76473864 TTAAAACTCTCACACATTGCTGG + Intronic
975888441 4:78994218-78994240 TCGAAACTCTCACACATGGCTGG - Intergenic
976243911 4:82988661-82988683 CTGGAACTCTCATACATTGCTGG - Intronic
976273701 4:83254867-83254889 CTGGAACTCTTATACATTGCTGG - Intergenic
976554966 4:86439707-86439729 CTAGAACTCTCACACGTTGCTGG - Intronic
977149642 4:93494416-93494438 CAGAAACTCTTCCACTTTGCTGG + Intronic
977585034 4:98765510-98765532 CTGGAACCCTCATACATTGCTGG - Intergenic
977717833 4:100202745-100202767 CTGGAACACTCATACATTGCTGG - Intergenic
978091305 4:104719649-104719671 CTGAAACTCTCATACATTGCTGG + Intergenic
978907831 4:114029466-114029488 CTGAAATTCTCACATGCTGTGGG - Intergenic
979195789 4:117918390-117918412 TTGGCACTCTCACACATTGCTGG - Intergenic
979363424 4:119791849-119791871 CTGGAACTCTCAAACATGGCTGG - Intergenic
979702228 4:123682816-123682838 CTGAAACTCCCATGCTTTGCTGG - Intergenic
980351200 4:131686390-131686412 CTGGAACTCTCATACCTTGATGG - Intergenic
980588643 4:134854214-134854236 CTGGAACTCTCATAAGCTGCAGG + Intergenic
980984054 4:139678354-139678376 CTGAAACTTTCATACAATGCTGG - Intronic
981323601 4:143421513-143421535 AGTAAACTCTCACACGCTGCTGG - Intronic
981838676 4:149085165-149085187 CTGGACCTCTCAGACATTGCTGG - Intergenic
981866867 4:149432172-149432194 CTCAAACACTCACACATTACTGG - Intergenic
982099957 4:151958077-151958099 CTGAGACTGTAACACGTTTCTGG + Intergenic
982149178 4:152433322-152433344 CTGAAACTCTCTTACATGGCTGG - Intronic
982223660 4:153146117-153146139 CTGGAACTCTCCTACATTGCTGG - Intergenic
982628377 4:157798168-157798190 CTGTGACTCTCATACGTTCCTGG - Intergenic
982716414 4:158813298-158813320 CAGAAACTCTCACCCATTGCTGG - Intronic
982796978 4:159658238-159658260 CTGAAACTCTCCCACTTTTTTGG + Intergenic
982940361 4:161544273-161544295 CTGGAACTCTTGCACATTGCTGG + Intronic
983193614 4:164781191-164781213 CTGGAATTCTCATATGTTGCTGG + Intergenic
983368079 4:166821317-166821339 CTGGAACTCTCATACACTGCTGG + Intronic
983716804 4:170791458-170791480 CTGGAATTCTCATACCTTGCTGG + Intergenic
983755274 4:171327562-171327584 CAGGAACTCCCACTCGTTGCTGG - Intergenic
984049756 4:174849851-174849873 CAGAAACTCTCATTCATTGCTGG - Intronic
984250387 4:177325671-177325693 CTGAAATTCTCATACTCTGCTGG - Intronic
984941267 4:184934329-184934351 GTAAAACCCTCACACATTGCTGG + Intergenic
984957467 4:185059805-185059827 CTGAAACCCTCACACATTGCTGG - Intergenic
984964650 4:185129217-185129239 CTGGAATTCTCCCACATTGCTGG - Intergenic
985351338 4:189065867-189065889 CTAAAACTCTACCATGTTGCTGG - Intergenic
985371948 4:189294656-189294678 TTGGAACCCTCACTCGTTGCTGG + Intergenic
985376128 4:189340799-189340821 CACAAACTCTCATACATTGCTGG + Intergenic
986205009 5:5615453-5615475 CTGTATCTCTCACACTTTGCTGG + Intergenic
986205180 5:5617561-5617583 CTGGATCTCTCATACATTGCTGG - Intergenic
986398555 5:7355568-7355590 CAGAAACTCTCAGACACTGCTGG - Intergenic
987039727 5:14050858-14050880 CTGAAACTCTTGTACATTGCTGG + Intergenic
987073069 5:14356502-14356524 TTGAAACTCTCATACGCTGCTGG + Intronic
987187431 5:15439044-15439066 GTGGAACTCTTACAGGTTGCTGG + Intergenic
987440856 5:17954684-17954706 TTGAAACTCTTACATGTAGCTGG + Intergenic
987511815 5:18848863-18848885 CCGTAATTCTCACATGTTGCAGG - Intergenic
987907573 5:24096745-24096767 CTGGAACTTTCATATGTTGCAGG - Intronic
988109352 5:26797705-26797727 TTGAAACTTTCACACATTGTTGG - Intergenic
988979438 5:36551730-36551752 CTGAAACTCTTATGCATTGCTGG + Intergenic
989174889 5:38514504-38514526 CTGGAACTTTCATACGTTACTGG - Intronic
989218536 5:38929586-38929608 CTGGAACTCCCATACCTTGCTGG + Intronic
990218277 5:53558881-53558903 CTGGATCTCTCATACATTGCTGG + Intergenic
990992018 5:61695887-61695909 ATGAAACTCTCACACATTGTAGG + Intronic
991947356 5:71912199-71912221 CTGGAACTTTCATACATTGCTGG + Intergenic
992007914 5:72496750-72496772 CTGAAATTCCCATATGTTGCTGG - Intronic
992011937 5:72537055-72537077 CTAAAACTCTGACACATTGCTGG + Intergenic
992071016 5:73149271-73149293 CTAGAACTCTCATATGTTGCTGG + Intergenic
992094135 5:73344836-73344858 CTGGAACTCTCATCCGCTGCTGG - Intergenic
992148032 5:73872104-73872126 CTGGAACCCTCATACATTGCTGG - Intronic
992245617 5:74819427-74819449 CTGCAACCCTCACACATTGCTGG + Intronic
992262169 5:74982286-74982308 CTGGAACTCTCATACACTGCTGG + Intergenic
992372671 5:76160906-76160928 TTGAAACCCTCACACACTGCTGG + Intronic
992445352 5:76828290-76828312 TTGAAACTCTCAGACACTGCTGG - Intronic
992600998 5:78399432-78399454 CAGAAACTCTCATTCATTGCTGG - Intronic
992805540 5:80333524-80333546 CTGGAACTCTCATACATTGCTGG - Intergenic
993429325 5:87812701-87812723 CTGCAATTCTCATACCTTGCTGG - Intergenic
993603683 5:89960186-89960208 CAGGAACTCTCATTCGTTGCTGG - Intergenic
994371364 5:98971171-98971193 CTGAAACTCTCACACACTTTTGG + Intergenic
994456266 5:100011953-100011975 CTGGAGCTCTCATACATTGCTGG + Intergenic
994699059 5:103110617-103110639 CTGGAACTCTCATACATTGTGGG + Intronic
994758194 5:103820105-103820127 ATGAAACTCTTACACATTGCTGG - Intergenic
994992199 5:107011111-107011133 CTGCAATTCTCACACGTAGAGGG - Intergenic
995364210 5:111337462-111337484 CTGAAACTCTCACACATCACTGG - Intronic
996026773 5:118655177-118655199 CAGAAACTCTCATTCATTGCTGG - Intergenic
996448366 5:123585818-123585840 CTGAAACTCCCATACATTGCTGG + Intronic
996621500 5:125509750-125509772 CTAAAAGTATCACACGTGGCCGG + Intergenic
997067130 5:130574331-130574353 CGGAAACTGTCACAAGTTGAAGG + Intergenic
997489891 5:134265115-134265137 CTGGAACTCTCAGTCTTTGCTGG + Intergenic
997755544 5:136395264-136395286 CTGAAACTCTCAAACACTGTTGG + Intronic
998196254 5:140074888-140074910 CTGGAACTTTCATACATTGCTGG - Intergenic
998311169 5:141134250-141134272 CTGGAACTCTCATACTTTGCTGG + Intronic
998540940 5:142980846-142980868 TTGAAACCCTCACACATTGCTGG - Intronic
998917085 5:147026006-147026028 CTGGAACTTTCATACATTGCTGG + Intronic
998917136 5:147026822-147026844 CTGGAACTCTCATACACTGCTGG + Intronic
998997876 5:147885707-147885729 CTGGATCACTCACACATTGCTGG + Intronic
999000569 5:147918077-147918099 CTAAAACTCTCATACCTTGTTGG + Intergenic
999104440 5:149058307-149058329 CTAGAACTCTCACACATTGCTGG - Intronic
999441976 5:151608675-151608697 CTGGAACTCTCATACACTGCTGG - Intergenic
999660455 5:153857073-153857095 CTGGAACTCTCATATATTGCTGG + Intergenic
999855574 5:155589486-155589508 CTGGAACTTTCACATGTTTCTGG + Intergenic
1000659890 5:163924879-163924901 CTGGAATTCTCACATATTGCTGG + Intergenic
1000993703 5:167937483-167937505 TGGGAACTCTCACACATTGCTGG - Intronic
1001272398 5:170324335-170324357 CTGGAACTCTTACATATTGCTGG + Intergenic
1001340926 5:170844779-170844801 CCAAAACCCTCACATGTTGCTGG - Intergenic
1001531752 5:172467229-172467251 CTGGAACCCTCATACATTGCTGG - Intergenic
1001738390 5:174027162-174027184 CAGAAACTCTCATTCATTGCTGG + Intergenic
1002348960 5:178569040-178569062 TTGGAACTGTCATACGTTGCTGG - Intronic
1002511217 5:179719225-179719247 CTGAAACCCTCATACACTGCTGG - Intronic
1002893252 6:1356170-1356192 ATGGAACACTCATACGTTGCTGG + Intergenic
1003233876 6:4278644-4278666 CTGGAACTCTCATACACTGCTGG - Intergenic
1003451557 6:6238883-6238905 CTGGAACTCTCATATGTTGCTGG + Intronic
1003684788 6:8291593-8291615 CTGGAACTCTCAAACATTGCGGG - Intergenic
1004433224 6:15565206-15565228 CTGAAACCCTAATACATTGCTGG + Intronic
1004624717 6:17363990-17364012 CTGCAACTCTCATACATTGCTGG - Intergenic
1004695773 6:18031448-18031470 CTGGAACACTCATACATTGCTGG + Intergenic
1004737067 6:18418112-18418134 TTGAAACTCTCATACACTGCTGG + Intronic
1006406147 6:33846514-33846536 CTGGAACTCTCAGACACTGCAGG + Intergenic
1006590593 6:35152818-35152840 CTGAAACTTTCATACACTGCTGG - Intergenic
1007921393 6:45612931-45612953 CTGAAGCTCTCATACAATGCTGG - Intronic
1007968011 6:46021304-46021326 CTGGAACTCTCATACATTGATGG + Intronic
1008105479 6:47436578-47436600 CTGAAGCTCTCATACATTGCTGG + Intergenic
1008322957 6:50140217-50140239 CGGAAACTCTCATTCATTGCTGG - Intergenic
1008742727 6:54629233-54629255 CTGGTACTCTCATACATTGCTGG + Intergenic
1008949315 6:57138199-57138221 CTGAAACCCACAAACATTGCTGG - Intronic
1009722656 6:67493334-67493356 CTGAAACTTTTATACATTGCTGG - Intergenic
1010706785 6:79123715-79123737 CTGGAACTCTCATACATTTCTGG + Intergenic
1010834963 6:80574553-80574575 CTGAAACCCTCATAGATTGCTGG - Intergenic
1010916018 6:81619883-81619905 CTGGAACCCTCATACATTGCTGG - Intronic
1011191326 6:84731655-84731677 CTAGAACCCTCACACATTGCTGG + Intronic
1011542253 6:88443705-88443727 CTGAAACTCTAATAAATTGCTGG - Intergenic
1011658091 6:89569706-89569728 CTGAAACCTTCATACATTGCTGG - Intronic
1011701247 6:89957023-89957045 CTGAATCTCTTACACACTGCAGG + Intronic
1012059010 6:94453447-94453469 CTGAAGCTCTCAAACTTTGCTGG + Intergenic
1012327619 6:97942605-97942627 CAGCAACTCTCACATATTGCTGG - Intergenic
1012366739 6:98450172-98450194 CTAGAACTCTCACGCATTGCTGG - Intergenic
1012975337 6:105775449-105775471 CTGGAACTCCCACACATTGCTGG + Intergenic
1013064980 6:106675083-106675105 CTGAAACCCTCATGCATTGCTGG - Intergenic
1013278595 6:108611480-108611502 CTAGAACTCTCATACATTGCTGG - Intronic
1013504338 6:110784509-110784531 CTGAAACCCTCATACATTTCAGG + Intronic
1014062212 6:117084785-117084807 CTGAAACTCTTATAAATTGCTGG + Intergenic
1014126761 6:117784992-117785014 CTGGAACTCTCATACATTACTGG - Intergenic
1014340673 6:120203058-120203080 CTGGAACTCTCATACATTGCTGG + Intergenic
1014488493 6:122031839-122031861 CTGGATCTCTCATACATTGCTGG - Intergenic
1015693010 6:135946518-135946540 TGGATACTCTCACACATTGCGGG - Intronic
1015789174 6:136949304-136949326 CAGGAACTCTCACTCATTGCTGG + Intergenic
1015966001 6:138695504-138695526 CTGGAACCCTCATACATTGCTGG - Intergenic
1016264126 6:142212043-142212065 CAGAAACTCTCATTCATTGCTGG + Intronic
1016341778 6:143069434-143069456 GTGGAGCTCTCACACATTGCTGG - Intronic
1016488979 6:144575005-144575027 CTGCAACTCTCATACATTGCAGG - Intronic
1016559636 6:145380828-145380850 CTGAGACTCTCACACATTGCTGG + Intergenic
1017056982 6:150445591-150445613 CTGGAACTCTCATACGTTGTTGG - Intergenic
1017562786 6:155648017-155648039 CTGAAACTCACAGAGGTTGAGGG - Intergenic
1017802884 6:157914104-157914126 CTGATACTCTCATATATTGCTGG - Intronic
1017810746 6:157981861-157981883 GTGAAACTCTGGCAAGTTGCGGG + Intergenic
1017886309 6:158602483-158602505 CTGAAACCCTCACACGCTACTGG - Intronic
1017968862 6:159291650-159291672 CTGACACTCTCATAAATTGCTGG - Intergenic
1018693814 6:166373705-166373727 CAGGAACTCTCATTCGTTGCTGG - Intronic
1018911680 6:168104527-168104549 CAGGAACTCTCACTCATTGCTGG + Intergenic
1019093168 6:169556935-169556957 CTGAGACTCTCATACCTTGCTGG + Intronic
1019566410 7:1681714-1681736 CTGGAACCCTCACGTGTTGCTGG - Intergenic
1019787951 7:2991062-2991084 CTGGAACTCTCATACATAGCTGG + Intronic
1019941281 7:4293447-4293469 CTGGAACTCTCATACATTGCTGG + Intergenic
1020807765 7:12811416-12811438 TTGGAACTCCCACACATTGCTGG - Intergenic
1020965832 7:14866844-14866866 CTGGAACTCTCACTCATTGCTGG - Intronic
1021008739 7:15435335-15435357 CTTGAACTCTCACACACTGCTGG - Intronic
1021023510 7:15634940-15634962 CTGAAACTCTCACACCTCTAAGG - Intronic
1021086481 7:16425886-16425908 CAGAAACTCTCATTCATTGCTGG - Intergenic
1021139102 7:17001901-17001923 CTGGAACTCTCATATATTGCTGG - Intergenic
1021751129 7:23801171-23801193 CTGAAACTTTCATAAATTGCAGG - Intronic
1022086683 7:27075268-27075290 CTGGAACTCTCATACATTGATGG + Intergenic
1022116549 7:27265989-27266011 CTGGAACTTTCATACATTGCTGG - Intergenic
1022356965 7:29625012-29625034 CTGGAACCCTCATACATTGCAGG + Intergenic
1022420285 7:30214490-30214512 TTGGAACTCTCATACATTGCTGG + Intergenic
1022511818 7:30939999-30940021 CTAAAACTCTCTTACGTTGCTGG - Intronic
1023001863 7:35816691-35816713 CTGGAACTCTCATACACTGCTGG - Intronic
1023364417 7:39449472-39449494 CTGGAATTCTCATACATTGCTGG + Intronic
1023589781 7:41769347-41769369 CTGGAACTCTCATACGTTGCTGG - Intergenic
1024197905 7:47077701-47077723 CTGAAGCTCTTAAACATTGCTGG + Intergenic
1024312720 7:47984214-47984236 CAGGATCTCTCACACGTTGCTGG - Intergenic
1024424950 7:49214732-49214754 CAGGAAGTCTTACACGTTGCTGG - Intergenic
1024455544 7:49601924-49601946 CAGAAGCTCTCATTCGTTGCTGG - Intergenic
1024602767 7:50999301-50999323 CTGGAACTCTCAAACACTGCTGG + Intergenic
1024659559 7:51479925-51479947 CTGAGAGTCTCAGAAGTTGCAGG + Intergenic
1025922747 7:65928849-65928871 CTGAAACTCTCACACATTGCTGG - Intronic
1026530443 7:71192758-71192780 CCGGAACTCTCATATGTTGCAGG - Intronic
1026623038 7:71967910-71967932 CTGGAACTCTCATATATTGCTGG + Intronic
1026627122 7:72005017-72005039 CTGAATCACTCATACATTGCTGG + Intronic
1027048374 7:75006345-75006367 CTGGAACTCTCTCATGCTGCTGG - Intronic
1027291310 7:76714405-76714427 CTGTAAGTCTCATATGTTGCTGG - Intergenic
1027788304 7:82608182-82608204 TTGAAACTCTCATACATTGCTGG + Intergenic
1028181914 7:87734167-87734189 CTGAATCTTTCATACATTGCTGG + Intronic
1028486876 7:91368858-91368880 CTAAAACTCCCATACATTGCTGG - Intergenic
1028609051 7:92688209-92688231 CTGTAACTCTCATACATTTCTGG - Intronic
1028637806 7:93009658-93009680 CTGAAATTCTCATACACTGCTGG - Intergenic
1029138754 7:98394608-98394630 CTGGAACTCTCATACTCTGCTGG + Intronic
1030405716 7:109110411-109110433 ATGGAACTCTCATACATTGCTGG + Intergenic
1030827482 7:114177345-114177367 CTTAAACTTTCACACATTGATGG - Intronic
1030923119 7:115417494-115417516 CTGAATCACTCATACATTGCTGG + Intergenic
1031047795 7:116912904-116912926 CTGAAACTCTTATACACTGCTGG - Intronic
1031341317 7:120605682-120605704 ATGGAACACTCACACATTGCTGG - Intronic
1031505584 7:122577773-122577795 CAGAAACTCTTACTCATTGCTGG - Intronic
1031723160 7:125202688-125202710 CTGGAACTCTCAGACACTGCTGG - Intergenic
1031767366 7:125798352-125798374 CTAGAACTCTAATACGTTGCTGG - Intergenic
1032373568 7:131385477-131385499 CTGGAACTCTCATGCATTGCTGG - Intronic
1032494488 7:132350665-132350687 TTGGAACCCTCACACATTGCTGG + Intronic
1032761108 7:134943060-134943082 CTAAAACTCACATACGTTGGTGG - Intronic
1032887598 7:136158369-136158391 CTGGATCACTCACACATTGCTGG - Intergenic
1032980543 7:137277293-137277315 CTTTAACTCTCACACTTTACTGG + Intronic
1033287305 7:140052977-140052999 CTGAAACTCTCACACGTTGCTGG + Intronic
1033375631 7:140759318-140759340 CTGGAACTCTCATACATTGCTGG - Intronic
1033810377 7:145004814-145004836 CTGGAAATCTCATACATTGCTGG - Intergenic
1034476396 7:151286336-151286358 CTGAATCACTCATACATTGCTGG + Intergenic
1034586415 7:152097379-152097401 CTGGAGCCCTCACATGTTGCTGG + Intronic
1034915058 7:155031709-155031731 CTGGAACTCTCATGCATTGCTGG + Intergenic
1035069553 7:156132068-156132090 CTGGATCACTCACACGTCGCTGG - Intergenic
1035862887 8:3049108-3049130 CAGGAACTCTCACTCATTGCTGG + Intronic
1036054402 8:5234691-5234713 CAGAAACTCTCATTCGTTGCTGG - Intergenic
1036119075 8:5995462-5995484 CTGGGACTCTCAGACATTGCTGG + Intergenic
1037161207 8:15774855-15774877 ATGAAGCTCTCATACGTTGTGGG + Intergenic
1037250178 8:16883762-16883784 CTGAAACTCCCATACGCTGCTGG + Intergenic
1037340851 8:17843124-17843146 CTAGAAGTCTCATACGTTGCTGG + Intergenic
1037368689 8:18149797-18149819 CTGAAAGTCTCATCAGTTGCAGG - Intergenic
1037699388 8:21260857-21260879 CTGGAACTCTCATACATTACTGG + Intergenic
1037724988 8:21475702-21475724 CAGGAACTCTCACTCATTGCTGG + Intergenic
1038184625 8:25262165-25262187 CTGGAACTCTCTCTCATTGCTGG - Intronic
1038475035 8:27859875-27859897 CTGGAACTCTCATACTCTGCTGG - Intergenic
1038630709 8:29240835-29240857 CTGGAACTCTCACGCATTGCTGG + Intronic
1038724430 8:30067931-30067953 CTGGAACTTTCATACTTTGCCGG - Intronic
1038886973 8:31674349-31674371 GTGAAACCCTTATACGTTGCGGG - Intronic
1039003692 8:33010205-33010227 GTGAAACTCTCATAAGCTGCAGG - Intergenic
1039093857 8:33861771-33861793 CTGAAACTCTCATATATTACTGG - Intergenic
1040448123 8:47516886-47516908 CTGAAACTCCCATGCATTGCTGG - Intronic
1040534135 8:48291516-48291538 CTGAATCACTCATACATTGCTGG - Intergenic
1040590253 8:48786126-48786148 CTGAAACTCTCAAATGCTGCTGG + Intergenic
1040707050 8:50141297-50141319 CTGAAGCTCTTACAGGTTGCTGG - Intronic
1040945384 8:52879615-52879637 GTGAAACCCTCACACACTGCTGG - Intergenic
1041048565 8:53910469-53910491 TTGAAACTCTCATTCATTGCTGG + Intronic
1041092117 8:54311894-54311916 CTTGAACTCTCACACGCTGCTGG - Intergenic
1041256867 8:55986292-55986314 CTGGAAATCTCACACACTGCTGG - Intronic
1041373287 8:57187467-57187489 GTGGAACCCTCACATGTTGCTGG + Intergenic
1041486728 8:58385608-58385630 CAGAAACTCTCATTCATTGCTGG - Intergenic
1041578347 8:59426448-59426470 CAGAAACTCTCATTCATTGCTGG + Intergenic
1042127415 8:65552499-65552521 CAGGAACTCTCATTCGTTGCTGG - Intergenic
1042281948 8:67064654-67064676 CTGTAACTCTGGCACGTCGCCGG - Intronic
1042395803 8:68291151-68291173 CTGGAACTCTCATATATTGCAGG - Intergenic
1042864675 8:73346711-73346733 TTGGAACCCTCATACGTTGCTGG + Intergenic
1043272072 8:78347236-78347258 CTGAAACTCACATACATTTCTGG + Intergenic
1043562576 8:81511545-81511567 CTGAAACTTTCATACACTGCTGG + Intergenic
1043856689 8:85273173-85273195 CTAGAAATCTCATACGTTGCTGG - Intronic
1043860229 8:85307835-85307857 GTGGAACCCTCATACGTTGCTGG - Intergenic
1044107182 8:88223886-88223908 ATGAAACTCTCCCACTTTTCAGG - Intronic
1044189832 8:89302043-89302065 CTGTAACTCTCATACATTGCTGG + Intergenic
1044230223 8:89766445-89766467 CTGGATCTCTCACACATTGCTGG - Intronic
1044269086 8:90219472-90219494 CTGGAACTCTCATGCATTGCTGG - Intergenic
1044339410 8:91029482-91029504 CTGAAAGTTTTACAGGTTGCTGG - Intronic
1044602810 8:94022629-94022651 CTGGAACTCTCCTACGTTACTGG + Intergenic
1044956761 8:97489334-97489356 CAGGAACTCTCACTCTTTGCTGG + Intergenic
1045014697 8:97990400-97990422 CTGGAACTCTCATAAATTGCTGG + Intronic
1045434513 8:102148251-102148273 CTGGAACTCTCATTCATTGCTGG + Intergenic
1045588688 8:103567775-103567797 GTAAAACCCTCACACATTGCTGG - Intronic
1045665462 8:104479663-104479685 CTGGAACCCTCATACATTGCTGG - Intergenic
1045795761 8:106041749-106041771 CTGAAACTATCATCCATTGCTGG - Intergenic
1046418790 8:113951063-113951085 CTGGATCTCTCATACTTTGCTGG - Intergenic
1046776634 8:118171200-118171222 TTGCAACTTTCACACATTGCTGG + Intergenic
1047196218 8:122724005-122724027 ATGAAACTCTCACATGTTACTGG - Intergenic
1047542498 8:125784281-125784303 CTGAAATTTTCACAGGTTGGTGG + Intergenic
1047866143 8:129026264-129026286 CTGAAACCCTCATACGTTTCTGG - Intergenic
1048006077 8:130420317-130420339 CTGGAACCCTCATACATTGCTGG + Intronic
1048038101 8:130696721-130696743 ATGGAACTCTCATACTTTGCTGG + Intergenic
1048717985 8:137289226-137289248 CTGGAATTCACACACGTTGCTGG - Intergenic
1049030208 8:140030388-140030410 CTGGAACTCTCAGAAATTGCTGG + Intronic
1049922482 9:378325-378347 CTGACACTCCCACACTTTTCTGG - Intronic
1049994588 9:1022807-1022829 CTGGAACTCTCATACATTGTTGG - Intergenic
1050795134 9:9529657-9529679 CAGCAACTCTCACTCATTGCTGG + Intronic
1050814264 9:9789299-9789321 CTGAAAATCTCATACGCTACGGG - Intronic
1050932378 9:11346825-11346847 CCGAAACTCTCATCCTTTGCTGG + Intergenic
1051017512 9:12497104-12497126 GTGAAACTCTCATATGCTGCTGG - Intergenic
1051198889 9:14595952-14595974 CTGGAACACTCATACATTGCTGG + Intergenic
1051442010 9:17095188-17095210 CAGGAACTCTCATACATTGCTGG - Intergenic
1051859006 9:21602858-21602880 ATGCTACTCTCACACATTGCTGG - Intergenic
1052284979 9:26774852-26774874 CTGGAGCTCTCATACATTGCTGG + Intergenic
1052286613 9:26793308-26793330 ACAAAACTCTCACACATTGCTGG + Intergenic
1052393726 9:27912139-27912161 CAGAAACTCTCATTCATTGCTGG - Intergenic
1052897871 9:33765019-33765041 CTGGAACTCTAATACATTGCTGG + Intronic
1053386514 9:37695271-37695293 CTGAAACTCTCACATACTGCTGG - Intronic
1053781510 9:41613315-41613337 CTGGAACTCTCATACCTTGATGG + Intergenic
1054169457 9:61823467-61823489 CTGGAACTCTCATACCTTGATGG + Intergenic
1054668080 9:67757348-67757370 CTGGAACTCTCATACCTTGATGG - Intergenic
1054832512 9:69642479-69642501 CTGGAAATCTCATAAGTTGCTGG + Intronic
1054876652 9:70104320-70104342 TTGGAACTCTCATACATTGCTGG + Intronic
1055588086 9:77777843-77777865 CTGGAACGCTAACACATTGCTGG + Intronic
1055620337 9:78119047-78119069 CTGGAACTCTCAGATATTGCTGG + Intergenic
1055631392 9:78227682-78227704 TTGAAACCCTCATACATTGCTGG - Intergenic
1055682768 9:78734944-78734966 CTGAAACACTCATACTTTGGTGG - Intergenic
1056066796 9:82944114-82944136 CTGGAACTCTCATCCATTGCTGG - Intergenic
1056695244 9:88843911-88843933 CTGTAACTCTCATACACTGCTGG - Intergenic
1056784211 9:89577510-89577532 CTGGAACTCTCACACATGGCAGG - Intergenic
1056878086 9:90357235-90357257 CTGAAACTCTCATACATTGCTGG + Intergenic
1056914569 9:90734808-90734830 CTGGATCTTTCACACGTTGCTGG + Intergenic
1057104178 9:92395626-92395648 CTGGAACTCTCATATGCTGCTGG - Intronic
1057406708 9:94778172-94778194 CTAGAACTCTCATACATTGCTGG + Intronic
1057456906 9:95221887-95221909 CTGGAACTCTCATAGGTTGGTGG + Intronic
1057564032 9:96152638-96152660 GTGAAACTCTCACACTATGAGGG + Intergenic
1057634447 9:96750637-96750659 TTGAAACCCTCATACATTGCTGG - Intergenic
1057846089 9:98525535-98525557 CTGGAACCCTCATACCTTGCTGG + Intronic
1057847204 9:98534752-98534774 CAGAAACTCTCATTCATTGCTGG + Intronic
1057894548 9:98897861-98897883 CTGAAACTCACATTCTTTGCTGG + Intergenic
1057946332 9:99332524-99332546 CTGAAACTCTCAAACATTGCTGG + Intergenic
1058513861 9:105749980-105750002 TTGGAAATCTCACACATTGCTGG - Intronic
1059129570 9:111732171-111732193 CTGGATCTCTCACACATTGCTGG + Intronic
1059347727 9:113641712-113641734 CTGGAATTCTCATATGTTGCCGG - Intergenic
1059503032 9:114772014-114772036 TTGGAACTCTCACACGTTGCTGG - Intergenic
1059621409 9:116009848-116009870 TTGGAACTCTCACACATTGTTGG - Intergenic
1060503008 9:124177172-124177194 CTGGAACTCTCATAGATTGCTGG - Intergenic
1060803505 9:126559666-126559688 CAGAAACTCTCATTCATTGCTGG + Intergenic
1061470613 9:130822360-130822382 CTGGAACACTCACACATTGCTGG - Intronic
1061585174 9:131562237-131562259 CTGGAACTCTCATTCATTGCTGG - Intergenic
1061645798 9:132000378-132000400 CTGGAACTCTCATACCCTGCTGG + Intronic
1062632833 9:137473826-137473848 CTCGAACTCTCAGACATTGCTGG + Intronic
1186087737 X:6009379-6009401 CTGGAACTCTTTCACATTGCTGG - Intronic
1186597333 X:10997641-10997663 CTGGAACTCTCACAGACTGCTGG + Intergenic
1187102279 X:16206099-16206121 CTGGAACTCTCATACACTGCTGG - Intergenic
1187351341 X:18520689-18520711 TTGGAACTCTCATACATTGCTGG - Intronic
1187369655 X:18694395-18694417 CTCGAACTCTAACACTTTGCTGG - Intronic
1187551321 X:20308670-20308692 CTGAAACTCTTATACATTGCTGG - Intergenic
1187687239 X:21827755-21827777 CTGGAACTCTCTCACATTGCTGG + Intergenic
1187828550 X:23357413-23357435 CTGGAACTCTTATACATTGCTGG + Intronic
1188241913 X:27802947-27802969 AAGGAACTCTCACACCTTGCTGG - Intergenic
1188414085 X:29910896-29910918 CTGGAACCCTCATACATTGCTGG + Intronic
1188521307 X:31041208-31041230 CTGAATCTTTCACACATTGTTGG + Intergenic
1188875248 X:35421853-35421875 CTGGAACTCTTGCACGTTGTTGG + Intergenic
1189352683 X:40288229-40288251 CTGGAACTCTCATACTTTGCTGG - Intergenic
1189477805 X:41369861-41369883 CTGGAACTCTCATACACTGCTGG - Intergenic
1189525881 X:41821444-41821466 CTGTAACTCTCATACATTACTGG + Intronic
1189760592 X:44317900-44317922 TTGGAACTGTCACACCTTGCTGG + Intronic
1189828334 X:44943907-44943929 GTGGAACTCTCATACATTGCTGG - Intronic
1189831364 X:44976944-44976966 CTGGAACCCTCACACATTACTGG - Intronic
1189880056 X:45481490-45481512 CTGGAACTCTCATACTCTGCTGG + Intergenic
1190001126 X:46688287-46688309 CTGTAACTCTCATGTGTTGCTGG - Intronic
1190008927 X:46766378-46766400 CTGGAACTCTCTTACATTGCTGG + Intergenic
1190158697 X:48014682-48014704 CTGAAGCTCTCATACATTGTTGG + Intronic
1190174395 X:48136970-48136992 CTGAAGCTCTCATACATTGTTGG + Intergenic
1190478976 X:50856108-50856130 TTGGAACTCTCATACATTGCTGG - Intergenic
1190571045 X:51781812-51781834 ATGATACTCTCCCATGTTGCTGG + Intergenic
1191699533 X:64024957-64024979 TTGAAACTCTCATGCATTGCTGG - Intergenic
1192085582 X:68093536-68093558 CTGGATCTCTCACACATTTCTGG - Intronic
1192275197 X:69622326-69622348 CTGAAATTCTCATACATTGCTGG - Intronic
1192346332 X:70310684-70310706 CTGGAACTCTCATACACTGCTGG - Intronic
1192388122 X:70694575-70694597 CTGAAACTCTCAAACACTGCTGG + Intronic
1192420289 X:71023297-71023319 CTGAAACCCTCATACTCTGCTGG + Intergenic
1193182947 X:78480287-78480309 CTGGAACCCTCATACATTGCTGG + Intergenic
1193651789 X:84144552-84144574 CTGAAACTCTCTTACGCTGCTGG + Intronic
1194672941 X:96756732-96756754 TTGGAACCCTCACACATTGCTGG - Intronic
1194779657 X:98009455-98009477 CTGACACTCTCAAACACTGCTGG - Intergenic
1194941153 X:100011968-100011990 CTAAAACGCTGACAGGTTGCTGG - Intergenic
1195231026 X:102847657-102847679 GTGAAACTCTCACACACTGCTGG - Intergenic
1195288355 X:103407428-103407450 ATAAAACTCTCACACACTGCTGG - Intergenic
1195477966 X:105308897-105308919 CTGGAACTCTCATACATTGCTGG - Intronic
1195552955 X:106189113-106189135 CTGGAACTCTCATACATTGCTGG - Intronic
1195584420 X:106548618-106548640 CAGAAACTCTCACTCATTGCTGG - Intergenic
1195682312 X:107557083-107557105 ATGAAACTCTCATACATGGCTGG - Intronic
1196002333 X:110799020-110799042 CTGGATCTCTCACACATTTCTGG - Intergenic
1196062189 X:111421349-111421371 CTGAATCTCTCATACACTGCTGG - Intergenic
1196091312 X:111746795-111746817 CTGGAATTCTCATACGCTGCTGG - Intronic
1196105913 X:111895149-111895171 CTGGAACTCTCATAGATTGCTGG - Intronic
1196317534 X:114246313-114246335 CTGGAGCTCTCATACATTGCTGG + Intergenic
1196465917 X:115971172-115971194 TTGAAACTGTCATACATTGCCGG + Intergenic
1196767302 X:119258920-119258942 CAGAAACTCTCATTCATTGCTGG + Intergenic
1197483829 X:127022150-127022172 TTGAAATTCTCACACATTGCTGG + Intergenic
1197845380 X:130796321-130796343 CTGAAACCCACAAATGTTGCAGG - Intronic
1198046453 X:132908289-132908311 CTGAAACCCTCATACATTGCTGG + Intronic
1198111614 X:133507241-133507263 CTGGAACCCTCATACATTGCTGG + Intergenic
1199371196 X:147050694-147050716 CTGAAACCTTCACACACTGCTGG + Intergenic
1199550289 X:149054106-149054128 TTGAAACTTTCATACATTGCTGG - Intergenic
1199555553 X:149104466-149104488 CTGAAACTCTCACACATTGCTGG - Intergenic
1199923753 X:152439481-152439503 CTGAGACTCTTACACACTGCCGG + Intronic
1199949369 X:152694938-152694960 CAGAAACTCTCATTCATTGCTGG + Intergenic
1199960307 X:152773511-152773533 CAGAAACTCTCATTCATTGCTGG - Intergenic
1200305043 X:155016316-155016338 CTGGAACTCTCATGCATTGCTGG + Intronic
1200306957 X:155036129-155036151 CTGGAACCCTCACACATTGCTGG - Intronic
1200324147 X:155220448-155220470 CTGGAACTCTTGTACGTTGCTGG - Intronic
1200620802 Y:5444587-5444609 CTGAAACTCTCTTACACTGCTGG + Intronic
1201508222 Y:14728224-14728246 CTGGAACTCTTTCACATTGCTGG + Intronic
1201584897 Y:15549465-15549487 CTTGAACTCTCAGACGTTGGGGG + Intergenic