ID: 1033288612

View in Genome Browser
Species Human (GRCh38)
Location 7:140062756-140062778
Sequence CGCAAGCGGCGCCGCAGCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033288605_1033288612 8 Left 1033288605 7:140062725-140062747 CCGCTCCAGCGCGTCGGCGCTCA 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1033288612 7:140062756-140062778 CGCAAGCGGCGCCGCAGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 65
1033288603_1033288612 17 Left 1033288603 7:140062716-140062738 CCGCAGCAGCCGCTCCAGCGCGT 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1033288612 7:140062756-140062778 CGCAAGCGGCGCCGCAGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 65
1033288606_1033288612 3 Left 1033288606 7:140062730-140062752 CCAGCGCGTCGGCGCTCAAGCCC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1033288612 7:140062756-140062778 CGCAAGCGGCGCCGCAGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 65
1033288602_1033288612 25 Left 1033288602 7:140062708-140062730 CCACGCTGCCGCAGCAGCCGCTC 0: 1
1: 0
2: 2
3: 41
4: 344
Right 1033288612 7:140062756-140062778 CGCAAGCGGCGCCGCAGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 65
1033288601_1033288612 26 Left 1033288601 7:140062707-140062729 CCCACGCTGCCGCAGCAGCCGCT 0: 1
1: 0
2: 3
3: 40
4: 593
Right 1033288612 7:140062756-140062778 CGCAAGCGGCGCCGCAGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033288612 Original CRISPR CGCAAGCGGCGCCGCAGCTC GGG Exonic
906637212 1:47417315-47417337 CGAGGGCGGCGCCGCAGGTCCGG - Exonic
1079128495 11:17734812-17734834 AGCAAGCGGAGCAGCAGCCCGGG + Exonic
1084766376 11:71311689-71311711 CGGAAGGGGAGCCACAGCTCAGG + Intergenic
1086724617 11:90167209-90167231 CGCAAGCGCCCGCGCAGCCCCGG - Intronic
1090664141 11:128903828-128903850 CACAAGCTGCCCGGCAGCTCGGG - Intronic
1092564263 12:9648152-9648174 CGGAAGGGGCTCCGTAGCTCGGG + Intergenic
1094375447 12:29783891-29783913 CGCAGGCGGCGGCGGAGCGCGGG - Intronic
1098828485 12:75330068-75330090 GGCAACAGGCGCCGCAGCGCAGG + Intronic
1101910469 12:108857349-108857371 CGCACGCGCGGCCCCAGCTCCGG + Intronic
1102469999 12:113154463-113154485 CGCAGGCGGCGCTGAGGCTCAGG + Exonic
1103528051 12:121580480-121580502 CGCAGGCGCCGCCGCCGCCCGGG + Intronic
1106246421 13:27954020-27954042 GGCAGGCGGCGCTGCTGCTCCGG - Intergenic
1107624841 13:42272044-42272066 CGCCGCCGCCGCCGCAGCTCCGG - Intergenic
1108553021 13:51565278-51565300 AGAAAGTGGGGCCGCAGCTCTGG - Intergenic
1114522405 14:23347625-23347647 GGCCAGCGGCACCGCAGCCCTGG - Exonic
1117131922 14:52695577-52695599 CCCCAGCGGCGCCCCACCTCCGG + Exonic
1122719653 14:103715224-103715246 CGGGAGCCCCGCCGCAGCTCGGG - Intronic
1122816942 14:104318654-104318676 CGCATGTGCCGCCGCAGCTGGGG - Intergenic
1122961004 14:105093594-105093616 CGCCTGCGGCGGCGCAGCCCAGG - Intergenic
1128598607 15:68976010-68976032 CACAAGCGCTGCCGCAGCCCCGG + Intronic
1129287989 15:74541189-74541211 CGGAAGCGGCGCCGCGGGGCTGG - Exonic
1133311305 16:4848127-4848149 CGCTAGCTGCGCCGCCGCCCGGG + Intronic
1136268258 16:29133278-29133300 CACAAGCGGCCCCACAGCTCAGG - Intergenic
1142071570 16:88093616-88093638 CACAAGCGGCCCCACAGCTCAGG - Intronic
1142698987 17:1648472-1648494 CGGAGGCCGCGCAGCAGCTCGGG - Exonic
1148684762 17:49495242-49495264 CGGAGGCGGGGCCGCAGCACTGG + Intergenic
1148838390 17:50478743-50478765 GGCAGGTGGCGCCGCAGCCCCGG + Intergenic
1150168366 17:62966225-62966247 CGCTAGCGCCGCCGCCGCGCTGG - Intergenic
1150676046 17:67246097-67246119 CGCGGGCGCCGCTGCAGCTCGGG + Intergenic
1153805311 18:8705333-8705355 CGCCAGCGCCGCCGCGGCACCGG + Intergenic
1160465032 18:79069308-79069330 CGCAGGCGGCGCCTCAGCCGGGG + Intronic
1162959478 19:14117574-14117596 CACCCGCCGCGCCGCAGCTCCGG - Exonic
1163103249 19:15109793-15109815 CTCAGGCGGCGCCGCAGTTCCGG - Exonic
1163845818 19:19637620-19637642 CTCAAGCCCCGCCCCAGCTCTGG - Intronic
1168301448 19:55407417-55407439 CGCAGGCGGAGCAGGAGCTCGGG - Intronic
1168337689 19:55605673-55605695 CGGAGGAGGCGCCGCCGCTCCGG - Intronic
925610504 2:5697200-5697222 CGCTGCGGGCGCCGCAGCTCGGG - Exonic
934636260 2:95992266-95992288 TGCAGGCGGCACTGCAGCTCGGG + Intergenic
934836022 2:97590279-97590301 TGCAGGCGGCACTGCAGCTCGGG + Intergenic
938311166 2:130288846-130288868 CGCCTGCGGGGTCGCAGCTCCGG + Intergenic
946376035 2:219309363-219309385 CGCCAGCGTCGCTGCGGCTCCGG - Exonic
1170821155 20:19757443-19757465 GGGAACCGGCCCCGCAGCTCCGG + Intergenic
1171013723 20:21522300-21522322 GCCGAGCGGCGCCGGAGCTCGGG - Intergenic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1175107892 20:56627533-56627555 CGAAAGAGGCGCCGCACCTCTGG + Intergenic
1175267102 20:57709652-57709674 TGCATGCGGGGCCCCAGCTCCGG - Exonic
1175429054 20:58889963-58889985 CGCAGCCGCCGCCGCAGCTTCGG - Intronic
1176048113 20:63102974-63102996 CGGAAGAGGCCCCACAGCTCGGG + Intergenic
1179968052 21:44818171-44818193 CGCAGGCCGGGCCGCGGCTCTGG + Intronic
1183517104 22:38272948-38272970 GGCGGGCGGCGCCGCAGCCCCGG + Exonic
952383024 3:32818823-32818845 CAGCAGCGGCGCAGCAGCTCGGG + Exonic
966498018 3:180602451-180602473 CGGAAGAGGGGACGCAGCTCTGG + Intronic
968965151 4:3765940-3765962 CGGCGGCGGCGGCGCAGCTCCGG + Intergenic
972979466 4:44678427-44678449 GGCAAGCTGCGCCGCCGCTTCGG + Exonic
979688551 4:123537937-123537959 CGCAAGCGCCCGCGCAGCCCCGG - Intergenic
986637694 5:9839099-9839121 CCCTAGCGGCTGCGCAGCTCAGG - Intergenic
986747928 5:10760808-10760830 GGCAAGCGGGGCCGAAGCTCCGG + Intronic
996900369 5:128537320-128537342 GGCAAGCGGCTCCGCACCTAGGG - Intronic
1002401680 5:178994676-178994698 CGCACGCCGGGCAGCAGCTCGGG + Exonic
1006303999 6:33208233-33208255 CCCACGCGGGGCCTCAGCTCCGG - Intergenic
1006317673 6:33299780-33299802 AGGAAGCGGCGGCGCAGCTCAGG - Intronic
1006932435 6:37696332-37696354 CGCAAGCCGCGCGGCAACTCCGG + Intronic
1010703520 6:79078583-79078605 CGCACACGGAGCCGCAGCACAGG + Intergenic
1027361675 7:77416207-77416229 CGGAAGCGGCGGCGCAGGTGCGG - Exonic
1033033204 7:137846736-137846758 CGCAGGCGGCGCCGCTGCAGGGG + Exonic
1033288612 7:140062756-140062778 CGCAAGCGGCGCCGCAGCTCGGG + Exonic
1040887593 8:52282701-52282723 CCCCAGCGGCACTGCAGCTCTGG - Intronic
1042837754 8:73093070-73093092 CGCAGGCGCCGCCGGAGCCCTGG - Exonic
1043847286 8:85177524-85177546 CGCCCCCGCCGCCGCAGCTCGGG + Exonic
1044229540 8:89758129-89758151 TGCCAGAGGCGCCGCGGCTCAGG - Exonic
1046265427 8:111823622-111823644 CGCAAGCGCCACAGCAGCCCCGG + Intergenic
1060610534 9:124960326-124960348 CTCAAGCGACGCCCCAGCTTTGG + Intronic
1061790228 9:133055282-133055304 CGCAAGCCGCTCCACAGCCCTGG + Intronic