ID: 1033288665

View in Genome Browser
Species Human (GRCh38)
Location 7:140062954-140062976
Sequence AACCGAAAGCGGCCCCGGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 40}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033288661_1033288665 -9 Left 1033288661 7:140062940-140062962 CCGGCGGGAAACGAAACCGAAAG 0: 1
1: 0
2: 0
3: 4
4: 26
Right 1033288665 7:140062954-140062976 AACCGAAAGCGGCCCCGGGCCGG 0: 1
1: 0
2: 1
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033288665 Original CRISPR AACCGAAAGCGGCCCCGGGC CGG Exonic
922842027 1:228650399-228650421 ACCCCACAGCCGCCCCGGGCTGG - Intergenic
1065879576 10:30027338-30027360 ACGCGAAAGCGGCCCGGGGATGG + Exonic
1069695480 10:70382518-70382540 AGCCAAAAGCGGCCCGGAGCGGG - Intronic
1071734172 10:88279880-88279902 AACAGAAAGTGGCCCAGAGCTGG + Intronic
1076756090 10:132572488-132572510 CAGGGAAAGCAGCCCCGGGCGGG - Intronic
1079149382 11:17884053-17884075 AGAGGAAAGCGGCCCCTGGCTGG - Intronic
1082035501 11:47642332-47642354 GACCGAACGGGGCGCCGGGCGGG + Intronic
1090780497 11:130002560-130002582 AACCGACCGCGGACCCGGGTGGG - Intronic
1105293970 13:19072455-19072477 AACCGAAAGCGGTCAGGGGTGGG + Intergenic
1105658798 13:22470518-22470540 AACAGAAAGCGGCCCTGGCCAGG - Intergenic
1107603886 13:42040413-42040435 AACCGAAAGCGGCCGCCGGGTGG - Intronic
1117860976 14:60092242-60092264 AACCGAGAGCTGGCCCGGGCGGG + Exonic
1122061553 14:99139662-99139684 AACAGAATGCGGCCAAGGGCAGG + Intergenic
1132785731 16:1656227-1656249 CCCCGAAAGCGCCCCCGGGGAGG + Exonic
1139644784 16:68320544-68320566 AAGCGAAAGCCGCCCTGGGTGGG + Intronic
1151670735 17:75570463-75570485 AGCCGGAAGCGGCACCCGGCTGG + Exonic
1152887814 17:82862831-82862853 AACGGAATGAGGCCCCGGCCTGG - Intronic
1158954437 18:62524650-62524672 CTCCGAGAGGGGCCCCGGGCGGG - Intronic
1160771738 19:835146-835168 GACCGAACGTGGCCCCGAGCCGG - Intergenic
1160947882 19:1652026-1652048 AACTTTAAGCAGCCCCGGGCGGG - Intronic
1162031486 19:7919298-7919320 AACAGAAAGCGACACCCGGCCGG + Intergenic
1162728189 19:12702182-12702204 AACCCCGAGCGGCCCCGGGACGG + Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
925709202 2:6721547-6721569 AACCCAAAGCTGCTCTGGGCTGG - Intergenic
936038366 2:109129901-109129923 ATCCGTCAGCGGCCCCGCGCGGG + Exonic
937275059 2:120678988-120679010 AATCTGAAGAGGCCCCGGGCTGG - Intergenic
1179641608 21:42751312-42751334 CACCGTCAGCGGCCCAGGGCTGG - Intronic
1181756499 22:25028446-25028468 CACCAAAAGCGGCCCCGCTCTGG + Exonic
1182212448 22:28687955-28687977 AGTCGAAAGCGGCCCCGTGAAGG - Exonic
1183517629 22:38276344-38276366 AACTTACAGAGGCCCCGGGCTGG + Intergenic
1185268710 22:49918601-49918623 AACCAATAGCGGCGCGGGGCTGG + Intronic
956745386 3:72307069-72307091 AGCGGAAAGCAGCCCCTGGCTGG - Intergenic
968319250 3:197750525-197750547 AACCGACCGCAGCCCCGGCCGGG - Intronic
968479476 4:826897-826919 CACCGAAAGTGAGCCCGGGCCGG - Intergenic
968583400 4:1405121-1405143 ACCCGGAAGAGGCCCCGCGCAGG + Intronic
975710660 4:77157516-77157538 AACCCACGGCGGCCCTGGGCGGG - Intronic
1003206663 6:4018847-4018869 AACGGAAAGCGGCCTCGGGCAGG - Intergenic
1016376234 6:143423408-143423430 TACCGAAACCGGCAGCGGGCTGG + Intronic
1027361743 7:77416432-77416454 AACCGAAAGCAGCAGGGGGCGGG - Intergenic
1033288665 7:140062954-140062976 AACCGAAAGCGGCCCCGGGCCGG + Exonic
1040335592 8:46414383-46414405 CACCGAAGGCTGTCCCGGGCGGG + Intergenic
1057294647 9:93828056-93828078 AACCGCTGGCGGCCCAGGGCGGG + Intergenic
1057593125 9:96391230-96391252 GACTGAAAGCTTCCCCGGGCAGG - Intronic
1059942123 9:119368985-119369007 CCCCGAATGCGGCCCGGGGCCGG + Intronic
1060106444 9:120876332-120876354 AACCTGCAGCGGCCCCGGCCTGG - Intronic