ID: 1033297127

View in Genome Browser
Species Human (GRCh38)
Location 7:140150156-140150178
Sequence TGGTCAAAGCTGCTAGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033297127 Original CRISPR TGGTCAAAGCTGCTAGAAAC AGG (reversed) Intronic
900875117 1:5336993-5337015 TGGTCAAAGATGCCAGAATGAGG + Intergenic
902797441 1:18808672-18808694 TGCCCACAGCTGGTAGAAACAGG + Intergenic
905545292 1:38793045-38793067 TGCTCCATGCTGCTAGAAAGTGG + Intergenic
905779436 1:40694954-40694976 TGGTCAGAACTACTAGAGACTGG + Intronic
909827794 1:80147481-80147503 TGGACAAAGATGCAAGAAATTGG + Intergenic
912984087 1:114408906-114408928 TGGACACAGCTGAGAGAAACTGG - Intronic
918394332 1:184098333-184098355 TGGCCAAACCTGTTAGAAACAGG + Intergenic
922012908 1:221609921-221609943 TGGGCAAAGCTGCAGGAAAAAGG + Intergenic
922222288 1:223617923-223617945 TGGTCACAGCTGCCTGAACCGGG + Intronic
923404190 1:233644195-233644217 AGGTTAAAGCTGCTATAAAAAGG - Intronic
924386965 1:243508129-243508151 TATTCAAAGCTGCAAGAAAAAGG + Intronic
1064886261 10:20115797-20115819 TGCTCAAAGCTTCACGAAACTGG - Intronic
1066417531 10:35235171-35235193 TGGTCAAAGTTGATTGAAATTGG - Intergenic
1068269436 10:54700944-54700966 TGTTAAATGCTGCTAGAAAGAGG + Intronic
1069233349 10:66039598-66039620 TGGACAAAGCTGACAAAAACAGG + Intronic
1072917940 10:99551394-99551416 GGCTGAAAGCTGCTAGCAACAGG - Intergenic
1073532055 10:104241283-104241305 TGGTCATCGCTGCTATAAAAGGG - Intronic
1073975043 10:109090929-109090951 TGGTGAAAGCTTCTGGGAACAGG - Intergenic
1076314348 10:129530443-129530465 TGGGCTAAGGTGCCAGAAACTGG - Intronic
1078589770 11:12629818-12629840 TCGTCTAGGCTGTTAGAAACTGG - Intergenic
1079361512 11:19774102-19774124 TTGTCAAACCTGCCAGAAGCAGG + Intronic
1079524567 11:21369395-21369417 TGTTCTAAGATGCTAGAAACAGG + Intronic
1081573042 11:44303331-44303353 TGGTCAAGGCTGCTGGGCACTGG - Intronic
1083359000 11:62092317-62092339 TGGTCAAAGCTGATTGATATTGG + Intergenic
1092864528 12:12748401-12748423 TTCTCAAGGTTGCTAGAAACTGG + Intronic
1103454869 12:121057387-121057409 TGGTCAAAACTGGTGGAAATAGG + Intergenic
1104051944 12:125200925-125200947 AGATCAAAGCTCCTAGAATCTGG - Intronic
1105782464 13:23716321-23716343 TGGTCTAAGCGGCCAGGAACTGG - Intergenic
1112555068 13:100459585-100459607 TGGTAATAACTGGTAGAAACAGG + Intronic
1114408634 14:22479665-22479687 TGGTGAAAGATGCTAATAACTGG - Intergenic
1115287158 14:31727507-31727529 TGATCAAAGATTCTAGAAGCAGG + Intronic
1117155334 14:52933830-52933852 TGGTAAGAGCTACTAGAAAAAGG - Intronic
1121452768 14:94019979-94020001 TGGTAAAAACTTCTTGAAACAGG - Intergenic
1124373330 15:29115625-29115647 GGCTCAGAGCTGCTGGAAACAGG - Intronic
1126370307 15:47939029-47939051 TGTTCAGAGCTGCCAGGAACTGG - Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1129511321 15:76125203-76125225 TGGTGAAAGCTGCTTGACATTGG + Intronic
1130562563 15:84970149-84970171 TGAGCAAAGCTGCTAGCACCTGG - Intergenic
1140302380 16:73771095-73771117 AGGTCAAGGATGCTAGAGACTGG + Intergenic
1144963836 17:19063018-19063040 TGGATAAAGCTGCTATAAACAGG - Intergenic
1144984108 17:19189119-19189141 TGGATAAAGCTGCTATAAACAGG - Intergenic
1146079535 17:29765622-29765644 TAGACAAAGCAGCTAGAATCTGG - Intronic
1146992072 17:37283540-37283562 TGGTCCAGACTGTTAGAAACTGG + Intronic
1147648688 17:42049970-42049992 TGGACAGAGCTGCTATAAACAGG + Intronic
1148892080 17:50815532-50815554 TGGTTAACGCTGCTAGGAAGTGG - Intergenic
1150102626 17:62437599-62437621 TGGCCAAAGCTGATTCAAACAGG - Intronic
1155928327 18:31680887-31680909 TGAGCAAAGCTTCTAGAAAATGG - Intronic
1155964591 18:32023989-32024011 TGGTCAAAGCTGACTGAAATTGG - Intronic
1156347324 18:36269476-36269498 TGGTCAAAGATGATACAGACAGG - Exonic
1163929723 19:20377492-20377514 TGGTAACAGCTGCAAGAAAAGGG - Intergenic
1166940590 19:46361885-46361907 TGGTCAAAGCTGATTGAGATTGG - Intronic
927004667 2:18835552-18835574 TAGTCAAAGCTGCCTGAAAATGG - Intergenic
927981920 2:27379877-27379899 TGGTCAAAGGTGATAGGAATAGG - Intronic
930354592 2:50301649-50301671 TTCTCAGAGATGCTAGAAACTGG - Intronic
930569626 2:53069105-53069127 TGATAACAGCTGCTATAAACAGG + Intergenic
931586400 2:63834587-63834609 TGGTAAATGCTGCTAGCAGCTGG - Intergenic
934158519 2:89225847-89225869 TGCTCACATCTGCTAGAAATAGG - Intergenic
934208754 2:89956580-89956602 TGCTCACATCTGCTAGAAATAGG + Intergenic
934295473 2:91739442-91739464 TGGTGAAAGCTGTCAGATACTGG + Intergenic
939775728 2:146385364-146385386 TGGGCAAAGCTGGGAGAAAAAGG + Intergenic
941505250 2:166336163-166336185 TAGCCAAACCTGCTAGAAAGAGG + Intronic
947273735 2:228368322-228368344 TGGACAAAGCTGGTGGAGACTGG + Intergenic
1171101393 20:22386706-22386728 TGGTCAAACCTGCTACAATAAGG + Intergenic
1173924558 20:46771190-46771212 TATCCAAAGCTGATAGAAACAGG + Intergenic
1176420495 21:6510337-6510359 TGGTCAAAGCTGCCTGAGAATGG + Intergenic
1178974042 21:37206922-37206944 TGGTCCTACCTGCTAGAACCAGG - Intergenic
1179695986 21:43118657-43118679 TGGTCAAAGCTGCCTGAGAATGG + Intergenic
1181507681 22:23371410-23371432 TGGACAGAGGTGCTAGAAAATGG - Intergenic
951755002 3:26081191-26081213 TGAGCAAAGCTGATAGGAACTGG + Intergenic
958118753 3:89257178-89257200 TGGTCTGAGCTGCTAGAAGAAGG - Intronic
958163257 3:89845957-89845979 AGGTCAAAGCTGTTTGAAAGAGG - Intergenic
959128737 3:102324317-102324339 TAGTCAAAGCTGAGAGAAAGAGG + Intronic
961739447 3:129023846-129023868 AGGACAAAGCTGATAGGAACTGG + Intronic
965665550 3:171089970-171089992 TGGTCACAGCTGATTGAATCAGG + Intronic
968358361 3:198125875-198125897 TTGTGAATGCTGCTATAAACAGG + Intergenic
968475635 4:805653-805675 TGGTTAATGCTGCTATGAACAGG - Intronic
974204158 4:58677788-58677810 TGGTCAAAGCTGATTGAGATTGG + Intergenic
974287700 4:59891318-59891340 TGGTGAAAGCTGCCAAAATCAGG - Intergenic
977320490 4:95508705-95508727 TGGTCAAAGTTTCTAGAAAAAGG + Intronic
978100245 4:104830068-104830090 TTTTAAAAGCTGCTAGAAACTGG - Intergenic
980967366 4:139535517-139535539 TGATCAAATCTACAAGAAACAGG + Intronic
981800358 4:148648369-148648391 TGGTCAGTGCTGCCAGGAACAGG + Intergenic
985335157 4:188884621-188884643 TGTTAAAAGCTACTAAAAACAGG + Intergenic
986387543 5:7249175-7249197 TGGGCAAAGATGCAAGAAGCTGG + Intergenic
986945467 5:13013182-13013204 TCGACAAAGCTGATAAAAACAGG - Intergenic
990522424 5:56592981-56593003 TGTTCTAAGCTGCAAGAAATGGG + Intronic
990544663 5:56810877-56810899 TGGCCAAAGCTGCTATAAAGAGG - Intergenic
997411514 5:133694628-133694650 TGGTCACAGGTGCTAGAAGCAGG - Intergenic
1001409980 5:171504491-171504513 AGGTCAAAGGTTCAAGAAACAGG - Intergenic
1004273715 6:14216946-14216968 TTTTCAAAGCTCCTTGAAACAGG - Intergenic
1007933562 6:45713792-45713814 TAGACAAAGGTGCAAGAAACAGG - Intergenic
1009904047 6:69846570-69846592 TGATCAAAGCTGCAAAAAAATGG + Intergenic
1010132017 6:72505433-72505455 TGGACCAAGCTGCAAGGAACTGG - Intergenic
1011594233 6:89000851-89000873 TGGTCAAAGCTGATTGAGATTGG + Intergenic
1011903275 6:92327802-92327824 CAGTCAAAGCTACTTGAAACAGG - Intergenic
1018595297 6:165473385-165473407 TAGACAAAGCTGATAGGAACAGG + Intronic
1020116090 7:5477269-5477291 TGGTCAAGGCTACCAGGAACTGG + Intronic
1020736932 7:11962377-11962399 TGGTCAAAGCTGATTGAGATTGG - Intergenic
1021131685 7:16920052-16920074 TCTTCAAAGCTGTTAAAAACAGG + Intergenic
1021283462 7:18749097-18749119 TGGTCACGACTGCAAGAAACTGG + Exonic
1021837256 7:24690991-24691013 TGGTCAAAGCAGTTAGTATCTGG - Exonic
1032031830 7:128490788-128490810 TGGCCAAAGCTGATTCAAACAGG - Intronic
1032752215 7:134852644-134852666 TGATCAAAGATGCTTTAAACTGG - Intronic
1032812410 7:135433903-135433925 TGGTCCTAGCTGCTAAACACAGG - Intronic
1033297127 7:140150156-140150178 TGGTCAAAGCTGCTAGAAACAGG - Intronic
1037946707 8:22994206-22994228 TGCACAAAGCTGCTTGACACTGG - Intronic
1038311910 8:26451241-26451263 TGGGCAAAACTGCTGGAACCAGG + Intronic
1040028606 8:42804066-42804088 GGCTTTAAGCTGCTAGAAACTGG + Intergenic
1045655465 8:104382442-104382464 TGGTCCAAGGTGGTAGAAATGGG - Intronic
1047039440 8:120976447-120976469 TGGCCAAAGATGATAGAACCAGG + Intergenic
1050354478 9:4769865-4769887 AGGTCAAAGCTGCTCTAAACGGG + Intergenic
1052432219 9:28381271-28381293 TGGTCAAACATGGTAGAAATAGG + Intronic
1056137155 9:83641696-83641718 TGGTAAAGGATTCTAGAAACTGG + Intronic
1057769430 9:97954548-97954570 TGATAGAATCTGCTAGAAACAGG - Intergenic
1060975482 9:127762509-127762531 TGGCCAAAGCTGCAGGAAAGAGG - Intronic
1062742233 9:138182417-138182439 TTGTGAATGCTGCTATAAACAGG + Intergenic
1186310527 X:8312905-8312927 TGTTGATAGCTGCAAGAAACTGG - Intergenic
1187434428 X:19254063-19254085 TGGTCAAAGATGCTAAAAAGGGG + Intergenic
1192810872 X:74546301-74546323 TGGTCACAGCTGGTTAAAACTGG - Intergenic
1194803076 X:98295324-98295346 TGGTCAGAGGTGTTTGAAACAGG + Intergenic
1194972612 X:100360759-100360781 TTGTTTAAGTTGCTAGAAACTGG - Intronic
1196106350 X:111900209-111900231 TGGTCAGAACTGCTGAAAACTGG + Intronic
1196212319 X:113009944-113009966 TGGTCACAGCTGGTATAAGCCGG - Intergenic
1199906019 X:152231715-152231737 TGAATAAAGCTGCTATAAACAGG - Intronic