ID: 1033300018

View in Genome Browser
Species Human (GRCh38)
Location 7:140177054-140177076
Sequence GCGCGCGAGGCCGCGGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 574
Summary {0: 1, 1: 0, 2: 6, 3: 81, 4: 486}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033300007_1033300018 21 Left 1033300007 7:140177010-140177032 CCGCCTCCTGCAGCAGCCGCGGC 0: 1
1: 0
2: 13
3: 125
4: 738
Right 1033300018 7:140177054-140177076 GCGCGCGAGGCCGCGGCGGCTGG 0: 1
1: 0
2: 6
3: 81
4: 486
1033300005_1033300018 27 Left 1033300005 7:140177004-140177026 CCAGCGCCGCCTCCTGCAGCAGC 0: 1
1: 0
2: 5
3: 87
4: 613
Right 1033300018 7:140177054-140177076 GCGCGCGAGGCCGCGGCGGCTGG 0: 1
1: 0
2: 6
3: 81
4: 486
1033300011_1033300018 15 Left 1033300011 7:140177016-140177038 CCTGCAGCAGCCGCGGCGGCGGC 0: 1
1: 11
2: 63
3: 254
4: 1079
Right 1033300018 7:140177054-140177076 GCGCGCGAGGCCGCGGCGGCTGG 0: 1
1: 0
2: 6
3: 81
4: 486
1033300013_1033300018 5 Left 1033300013 7:140177026-140177048 CCGCGGCGGCGGCGGCGCCTCAG 0: 1
1: 0
2: 6
3: 69
4: 395
Right 1033300018 7:140177054-140177076 GCGCGCGAGGCCGCGGCGGCTGG 0: 1
1: 0
2: 6
3: 81
4: 486
1033300009_1033300018 18 Left 1033300009 7:140177013-140177035 CCTCCTGCAGCAGCCGCGGCGGC 0: 1
1: 1
2: 6
3: 80
4: 544
Right 1033300018 7:140177054-140177076 GCGCGCGAGGCCGCGGCGGCTGG 0: 1
1: 0
2: 6
3: 81
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033300018 Original CRISPR GCGCGCGAGGCCGCGGCGGC TGG Intergenic
900162798 1:1232293-1232315 GCGGGCGTGGCGGCGGCGGGCGG + Exonic
900162827 1:1232420-1232442 GCGCGCGCGGGCGCGGGGGGAGG - Exonic
900309815 1:2028325-2028347 GCGCGCGCGGAAGGGGCGGCGGG - Intronic
900414683 1:2529542-2529564 GCGGGCGGGGGCGCGGCGCCCGG + Exonic
901109848 1:6785669-6785691 GAGCGCGGGGGCGCGGCGGGCGG + Intronic
901875902 1:12167044-12167066 GGGCGCGAGGGCGCGAGGGCAGG + Exonic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
902385565 1:16073626-16073648 GCGCGGGAGGCGGCGGCGCGAGG - Exonic
902501448 1:16914152-16914174 GCGCGCGCGTGCGCGGGGGCGGG + Intronic
902600894 1:17539701-17539723 TCGCGCACGGCGGCGGCGGCGGG + Intergenic
902823237 1:18956231-18956253 GCGGGGGCGGCGGCGGCGGCGGG - Exonic
902823255 1:18956264-18956286 GCCCGCCGGGCGGCGGCGGCGGG - Exonic
903063427 1:20685384-20685406 GCGGGGGAGGCCGTGGAGGCAGG - Intronic
903072199 1:20732053-20732075 AGGCGCGGGGCTGCGGCGGCGGG - Intronic
903078110 1:20787345-20787367 GCGCGGGAGGCGGGGCCGGCGGG - Intergenic
903413960 1:23168737-23168759 GTCCGTGAGGCGGCGGCGGCGGG - Intronic
903750211 1:25616798-25616820 GCCCGAGCGGCGGCGGCGGCGGG + Intergenic
903925134 1:26826625-26826647 CGGCGGGAGGCCGCGGCGGGCGG + Intergenic
904701698 1:32361914-32361936 GGGCGCGAGGCGGCGGCGCCCGG - Intronic
904772141 1:32886445-32886467 GCGCGCGCGGCAGGGGCGGCAGG - Exonic
905066843 1:35192088-35192110 GCGCGCGCCGCTGCGGGGGCGGG - Intronic
905670879 1:39789165-39789187 GCACGCGACGGCGGGGCGGCCGG - Intergenic
905960058 1:42035809-42035831 GCGCGCCGGGCCGGGGCGGCGGG + Intronic
906204337 1:43979183-43979205 GCGCGCGCGGGCGCGCGGGCCGG + Intronic
906377036 1:45304102-45304124 GCGCGCGGGGCCGCGGGGCAGGG - Intronic
906637076 1:47416835-47416857 GCGCACGCGGCCGCGGCGCCAGG + Exonic
907051153 1:51330563-51330585 GCGGTCGCGGACGCGGCGGCCGG + Intronic
907069297 1:51519312-51519334 GCAGGCGAGGCCGGGGCGGGCGG + Exonic
907278161 1:53328191-53328213 GAGGGCGAGGAGGCGGCGGCAGG - Intergenic
907905673 1:58782513-58782535 GCGCGCTGAGCAGCGGCGGCGGG - Exonic
910676437 1:89821144-89821166 GCGGGCGGGGCCGCGGGAGCAGG + Exonic
910981243 1:92961546-92961568 GCGCGCGCCGCGGCGGGGGCGGG - Intergenic
912305170 1:108560013-108560035 GCGCTGCAGGCCGCGGCCGCTGG + Intergenic
912381291 1:109249583-109249605 GGGCCCGGGGCCGCGGCGACAGG + Intergenic
912492386 1:110069550-110069572 GCCCGTGAGCCCGCGGCGCCAGG + Intronic
912716882 1:111989546-111989568 GCGCGCGAGGAAGCTGCGGCCGG + Intergenic
913300893 1:117367469-117367491 GCGGCGGCGGCCGCGGCGGCTGG + Exonic
914134149 1:144883863-144883885 GGGGGGGAAGCCGCGGCGGCGGG + Intergenic
914134189 1:144883960-144883982 GGGGGGGAAGCCGCGGCGGCGGG + Intergenic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
916729525 1:167553637-167553659 CCGCGCGGGGTCGCGGCGGCCGG - Exonic
916750835 1:167721827-167721849 CCGCGCGGGGCCGAGGCGCCTGG + Intronic
917974395 1:180229917-180229939 GGGCGCGAGCCCGCCACGGCTGG + Intergenic
918265672 1:182839548-182839570 GCGCGGGCGGCGGCGGCGGCTGG + Intronic
920394168 1:205631818-205631840 GCGCCAGGAGCCGCGGCGGCGGG - Exonic
920924487 1:210328894-210328916 GGGCGCGCGGGCACGGCGGCAGG + Exonic
921427530 1:215021789-215021811 GCGTGGGAGGCCGAGGCGGGCGG - Intronic
921472674 1:215567569-215567591 GCCAGCGGGGCGGCGGCGGCCGG - Exonic
922196590 1:223364529-223364551 GGGCGCGAGGCGCCGGCGGCCGG + Intergenic
922586410 1:226737555-226737577 GCGCGCGGAGCCGCGGCTGCCGG - Exonic
923008005 1:230067381-230067403 GCGCGGGCGGCGGCGCCGGCAGG + Exonic
923506304 1:234609256-234609278 GCGGCCGAGGCCGCGGCGCCGGG + Exonic
923986560 1:239387874-239387896 ACTCGCGAGGCAGCGGCCGCTGG + Intronic
1062843800 10:689750-689772 GCGCGCGAGGCGGCCGTGGCGGG - Intergenic
1063411829 10:5842174-5842196 GCGGGAGAGGGAGCGGCGGCGGG + Intergenic
1063929847 10:11018059-11018081 GCGCACGCGGCGGCAGCGGCGGG - Exonic
1064443214 10:15371388-15371410 GGGCGCGACGCAGCGGCGCCGGG - Intergenic
1065023198 10:21517329-21517351 GGGCGCGCGGCGGCGGCGCCCGG + Exonic
1065069026 10:22003347-22003369 GCGTCCGCGGCGGCGGCGGCGGG + Exonic
1065099093 10:22316271-22316293 CCGCGCGCGGGCGCGGAGGCGGG + Exonic
1065214697 10:23438876-23438898 GCGCGCGAGCGCGCGCGGGCGGG - Intergenic
1065589785 10:27252574-27252596 GCGCCCCTGGCGGCGGCGGCGGG - Intergenic
1065712824 10:28533494-28533516 GCGCAGGCGGCGGCGGCGGCGGG - Exonic
1065845130 10:29737016-29737038 GCGCGCCAGGCCGGCGGGGCCGG + Intergenic
1066126321 10:32346576-32346598 CCCCGCTGGGCCGCGGCGGCCGG + Intronic
1066599047 10:37084318-37084340 CCGCGGGAGGCCGAGGCGGGCGG + Intergenic
1066950403 10:42111620-42111642 GGGCGAAAAGCCGCGGCGGCGGG + Intergenic
1067028704 10:42866121-42866143 CCCCGCGAGCTCGCGGCGGCCGG - Intergenic
1067513093 10:46911540-46911562 GTGCGGGAGGCCGCTGCGCCGGG + Intronic
1067649160 10:48140302-48140324 GTGCGGGAGGCCGCTGCGCCGGG - Intergenic
1068690154 10:59906293-59906315 GCGGGGGAGGCGGCGGCGGTGGG - Exonic
1069386032 10:67884467-67884489 GCGCACTCGGCCCCGGCGGCCGG - Intergenic
1072331931 10:94362789-94362811 GGGCCCTAGGCCGCGGCGACCGG + Intronic
1072408991 10:95183569-95183591 TAGCGAGAGGCGGCGGCGGCCGG + Intergenic
1073147952 10:101292610-101292632 GCGGGCGCGGGCGCGGCCGCGGG - Intergenic
1073432142 10:103493811-103493833 GCGGGCGGGACCGCGGCGGTCGG + Intergenic
1073491352 10:103855362-103855384 GCGCGCCGGGCCGGGGTGGCGGG - Exonic
1074756511 10:116627817-116627839 GCGCACACGGCCGCGGAGGCGGG + Exonic
1074815417 10:117138243-117138265 GCGCGCGGGTCAGCGGCGACGGG + Intronic
1076035550 10:127196277-127196299 GCGCGCGGGGAGGCAGCGGCTGG + Intronic
1076726734 10:132417371-132417393 GCAGGTGAGGCCGGGGCGGCAGG - Exonic
1076916346 10:133424574-133424596 GAGCGCGGAGCCGCGGCGCCTGG + Intergenic
1076936453 10:133569369-133569391 GAGCGCGGAGCCGCGGCGCCTGG + Intronic
1077053100 11:576498-576520 GCGGCAGAGGCGGCGGCGGCCGG + Exonic
1077090761 11:777281-777303 GCGCCGGAGGCCGAGGCCGCTGG - Intronic
1077285688 11:1764222-1764244 GCGGGGACGGCCGCGGCGGCCGG - Intergenic
1078180004 11:9003714-9003736 GGGCGCGAAGCCGCCGGGGCCGG + Intronic
1078771753 11:14358582-14358604 GAGCGCGACGCTGCGGCCGCAGG + Intronic
1080386023 11:31811721-31811743 GCGGGCGGGGGCGGGGCGGCAGG - Intronic
1080540113 11:33257360-33257382 GGGCCCGAGGCTGGGGCGGCTGG + Intronic
1081812903 11:45923172-45923194 GTGCGCGCGGCCCTGGCGGCGGG + Intronic
1083448567 11:62727240-62727262 GCGCGTGAGGCGGAGGCGGGCGG - Exonic
1083538207 11:63491035-63491057 GCCGGCGAGGCCGCAGAGGCGGG - Exonic
1083933470 11:65858285-65858307 GCGAGCGAGGCGGCGGCGCAGGG - Exonic
1084070078 11:66728183-66728205 GCGGGCGGGGGCGCGGCGGGCGG + Intronic
1084171280 11:67401983-67402005 GGGGGCGGGGCCTCGGCGGCGGG + Intronic
1084310230 11:68312518-68312540 GCGCGGGTGGCGGCGGCGGGGGG + Intergenic
1084621178 11:70271037-70271059 GGGGGCGAGGCCGCGGCGCCGGG + Intronic
1084804764 11:71571302-71571324 GTGCCCCAGGCCCCGGCGGCGGG - Intergenic
1084805691 11:71577221-71577243 GTGCCCCAGGCCCCGGCGGCGGG + Intergenic
1085284627 11:75351727-75351749 GCGGGGGCGGCGGCGGCGGCCGG - Intergenic
1087014668 11:93543393-93543415 GCGCGCCAGACCGCAGCGCCAGG + Exonic
1087795660 11:102452806-102452828 GCGTGCGCAGCCGGGGCGGCGGG + Exonic
1089432714 11:118436693-118436715 GCGGCCGCGGCGGCGGCGGCGGG + Exonic
1089525594 11:119094735-119094757 GGGCCCGAGGCCGACGCGGCAGG + Exonic
1089543629 11:119206188-119206210 GCGCGCGAGCCCGGGGCGGGCGG - Exonic
1089700247 11:120240224-120240246 GCTCCCGCGGCGGCGGCGGCCGG + Intronic
1090635805 11:128689870-128689892 ACGTGGGAGGCCGCGGCGGCGGG - Intronic
1090699332 11:129279692-129279714 GCGCGCGCGGCCGAGGGGGCGGG + Intergenic
1091460920 12:642991-643013 GCGGAAGAGGCCGCGGCGGCCGG - Intronic
1092219124 12:6700760-6700782 GGGCGCGGGGCGGCGGCGGTGGG + Intronic
1092906021 12:13101318-13101340 GGGCGCGTTGCCGCGGCGACAGG + Intronic
1095261662 12:40105623-40105645 GCGCGGGCGGCGGCGGCGTCGGG - Exonic
1096389376 12:51217392-51217414 GCGGGCGAGGGCGCGGCCCCCGG + Intronic
1096495458 12:52037164-52037186 GCGCGGGCGGCCGCGGGCGCGGG + Intronic
1096691605 12:53325263-53325285 GACCGCGAGGCTGCGGCGGGCGG + Intergenic
1096784414 12:54009056-54009078 GCGCGGGCGGCGGCGGCGGCGGG - Intronic
1097264199 12:57736532-57736554 GTACGCGAGTCCGCGGGGGCTGG - Intronic
1097270759 12:57772525-57772547 GCGCTCGGGGCCGGGGCGGGAGG + Exonic
1097676160 12:62603846-62603868 GCCCGCGAAGCCTCGGCGCCCGG + Intergenic
1100540000 12:95548734-95548756 GGGCGCGCGGCCGCGGCGATTGG - Intronic
1100611396 12:96194346-96194368 GCGCACGGGGCCGGGGCGGCGGG + Intergenic
1101371714 12:104137574-104137596 GGGCGCGGGGCCGGGGCGGCCGG - Intronic
1101466907 12:104958325-104958347 CCGCGCGGGGGCGGGGCGGCGGG - Intronic
1102954537 12:117051020-117051042 GCGCCCGAGGCTGCTGGGGCAGG + Intronic
1103381278 12:120496077-120496099 GAGCACTAGGCGGCGGCGGCTGG + Intronic
1103954197 12:124567438-124567460 GCGCCCTAGGAGGCGGCGGCGGG - Intronic
1104912784 12:132247707-132247729 GCGAGTGAGGCCGCGGTGTCTGG - Intronic
1104912817 12:132247815-132247837 GCGAGTGAGGCCGCGGTGTCCGG - Intronic
1104929195 12:132329355-132329377 GCGCGCCGGGCCACGGCCGCCGG + Intergenic
1105389175 13:19959113-19959135 GCGGGCGAGGCCGGGAGGGCTGG + Intronic
1106248739 13:27968609-27968631 GCGCAGGAAGGCGCGGCGGCCGG + Exonic
1106516975 13:30464815-30464837 GCGGGCGCGGCGGCGGCGGCGGG + Intronic
1106735928 13:32587172-32587194 GCGCGCGGGGACCCGGCGGCGGG - Intronic
1108314040 13:49220789-49220811 GAGCGCGCGGACGCGGCGCCGGG - Exonic
1108373469 13:49792717-49792739 CGGCGCGCGGCCGCGGAGGCTGG + Exonic
1108407942 13:50124088-50124110 GCGGGCGAGGCCGCGGTGTCCGG + Intronic
1110573065 13:77026937-77026959 GCGCGGGGGGCCGCGGCTGCGGG - Exonic
1110705280 13:78596905-78596927 GCGCCAGAAGCCGCGGTGGCAGG + Intergenic
1111951687 13:94713184-94713206 GCCCGCGAGTCCGCCGCGCCCGG + Intergenic
1112282663 13:98076415-98076437 GCGCAGGAGCCCACGGCGGCGGG + Intergenic
1113311938 13:109140665-109140687 GCGCCGGAGGACGAGGCGGCGGG + Exonic
1113379302 13:109787266-109787288 GCTCGCGAACCCGCGGCCGCGGG - Intergenic
1113655927 13:112067762-112067784 GCGGGGGCGGCGGCGGCGGCGGG + Exonic
1113724520 13:112588182-112588204 GCACGCGCGGCCGCGGCGCAGGG - Intergenic
1113907426 13:113826374-113826396 GCCTGCGAGGCCGGGGAGGCTGG - Intronic
1115028185 14:28766608-28766630 GCGCCCGAGGGGGCGGCAGCCGG + Intergenic
1115399314 14:32939410-32939432 GCGGCGGAGGCGGCGGCGGCGGG - Intronic
1116886951 14:50231371-50231393 GGGCGGGAGGCGGCGGCCGCCGG - Exonic
1117875929 14:60249723-60249745 GCCTGCGCGGCGGCGGCGGCGGG + Intronic
1119410341 14:74426248-74426270 GAGAGGGAGGCGGCGGCGGCGGG - Intergenic
1121417477 14:93788946-93788968 CCGCGAGAGGCAGCGGCGGGAGG + Intergenic
1121617022 14:95320002-95320024 GCGAGCGAGCGCGGGGCGGCGGG + Intergenic
1122108561 14:99480141-99480163 GCGCGGGAGGAGGCGGGGGCTGG + Intronic
1122220978 14:100239072-100239094 GCGGGCGCCGCGGCGGCGGCGGG - Exonic
1122221237 14:100240064-100240086 GGGGGCGCGGCGGCGGCGGCGGG + Intronic
1122275118 14:100587196-100587218 GCGGGCGCGGGCGCGGAGGCGGG - Intronic
1122635372 14:103127262-103127284 GACCGCCAGGCGGCGGCGGCGGG + Exonic
1122666682 14:103334721-103334743 GCGCGCGGGGAGGGGGCGGCCGG - Intronic
1122750443 14:103928732-103928754 GCGGGCGGGGCGGAGGCGGCTGG + Intronic
1122779168 14:104136406-104136428 GCGGGCGGGGCGGCGGTGGCGGG + Intergenic
1122904501 14:104795581-104795603 GGGCTGGAGGCCGCGGCGGGCGG + Intronic
1124121694 15:26893884-26893906 GCGCGCGGGGCGGCGGCAGCCGG + Intronic
1124500959 15:30225785-30225807 GCACGCGAGGCCGCCGCCGGGGG - Intergenic
1124742611 15:32312882-32312904 GCACGCGAGGCCGCCGCCGGGGG + Intergenic
1125301035 15:38253092-38253114 GGGCAGGAGGCAGCGGCGGCCGG - Exonic
1125429469 15:39580937-39580959 GCGCGCCAGGCAGCGGGGGGCGG + Intergenic
1125508757 15:40281939-40281961 CCGCGGGAGGCGGCGGGGGCTGG + Exonic
1125516406 15:40323640-40323662 GCGCGCGAGGCGGGGGAGCCGGG + Intergenic
1125535863 15:40441053-40441075 GCGCGCCTGGCCGGGGCGGGCGG - Intronic
1125930176 15:43594383-43594405 GCGCGGGAGGAGGCGGGGGCAGG + Intronic
1125943344 15:43694215-43694237 GCGCGGGAGGAGGCGGGGGCAGG + Intronic
1126766996 15:52019420-52019442 GCTCGGGAGGGCGCCGCGGCGGG + Intronic
1127144111 15:56007289-56007311 GCGGGGGAGGCGGCGGCGGCGGG + Intergenic
1127144119 15:56007307-56007329 GCGGGGGAGGCGGCGGCGGCGGG + Intergenic
1127144127 15:56007325-56007347 GCGGGGGAGGCGGCGGCGGCGGG + Intergenic
1127144135 15:56007343-56007365 GCGGGGGAGGCGGCGGCGGCGGG + Intergenic
1127144143 15:56007361-56007383 GCGGGGGAGGCGGCGGCGGCGGG + Intergenic
1127763575 15:62164451-62164473 GCGCAGGAGGCGGCAGCGGCGGG + Exonic
1127931642 15:63600982-63601004 GCGCGCGCGGGCGCGGGGGCTGG - Intronic
1129428269 15:75480777-75480799 GCCCGCGAGGCAGCGGCTGGAGG + Intronic
1129690514 15:77710723-77710745 GCGAGGGAGGACGGGGCGGCTGG + Intronic
1130040838 15:80404344-80404366 CGGCGAGCGGCCGCGGCGGCGGG + Exonic
1132065543 15:98727855-98727877 GCGGGCCAGGCCGGGGCTGCTGG + Intronic
1132111709 15:99106193-99106215 GCGGGCGAGCGCGGGGCGGCAGG + Intronic
1132466207 16:78391-78413 GCGAGCGCGGCCGCGGGAGCGGG + Intronic
1132491608 16:234836-234858 GGGTGAGAGGCCGCGGCGGCAGG + Exonic
1132498593 16:275103-275125 GAGCGCGGGGCCGCGGAAGCGGG + Intronic
1132544805 16:528127-528149 GCGCAGGAGGCCTCGGGGGCCGG + Intronic
1132552774 16:560242-560264 GCGCGCCAGGGGGCGGCGGGGGG + Intergenic
1132585968 16:705868-705890 GCGCGCGAGGGCGCGGCGTTTGG - Intronic
1132616090 16:841833-841855 GGGCTCGAGGCTGCGGCAGCAGG - Intergenic
1132719651 16:1309485-1309507 GGGCGCGGGCGCGCGGCGGCGGG + Intronic
1133156603 16:3880547-3880569 GCGAGCGGGGCCGCCGGGGCGGG + Exonic
1133802034 16:9092026-9092048 CCGCGGGAGGCCGCGGAGGATGG + Exonic
1134018903 16:10907929-10907951 GCCCACGAGGCCGAGGAGGCTGG + Exonic
1134134170 16:11668629-11668651 GCGCGCGCGGCGGCGGGGCCGGG + Intronic
1134172113 16:11976882-11976904 GGGCGCGAGGACGCAGGGGCCGG - Intronic
1134519413 16:14911792-14911814 GGGCGCTAGGCCGCAGAGGCAGG - Intronic
1134554520 16:15154436-15154458 GGGCGCTAGGCCGCAGAGGCAGG + Intergenic
1134614840 16:15643113-15643135 GTGCGCTTGGCGGCGGCGGCGGG - Exonic
1134707083 16:16310447-16310469 GGGCGCTAGGCCGCAGAGGCAGG - Intergenic
1134960457 16:18401677-18401699 GGGCGCTAGGCCGCAGAGGCAGG + Intergenic
1135382755 16:22008189-22008211 GGGCGCGAGGCAGCGGCGCGGGG + Exonic
1135565856 16:23510421-23510443 GCGCCCGCGGCCGCAGCGTCGGG - Exonic
1136153680 16:28368191-28368213 GCACGCGAGGCCGCCGCCGGGGG - Intergenic
1137454733 16:48609746-48609768 GGGCGCGCGGGGGCGGCGGCCGG + Intronic
1137454806 16:48610075-48610097 GCGGGCGGGGGCGAGGCGGCCGG - Exonic
1137655138 16:50153164-50153186 GCGCGTGAGGGCGGGGCGGTGGG + Intronic
1138598451 16:58041693-58041715 GCTGGGGAGGCCGGGGCGGCCGG - Exonic
1139402941 16:66696653-66696675 GGGCGAGAGGCGGCGGCGGCGGG - Exonic
1139917799 16:70438990-70439012 GCGCGGGCGGCGGCGGCGGCCGG - Intronic
1141797927 16:86287094-86287116 GCGCGGGAGTGAGCGGCGGCGGG - Intergenic
1141960792 16:87406639-87406661 GCACGTGAGGCCGCGGCGGATGG + Exonic
1142240171 16:88941356-88941378 GCGCGCGGGGCGGGGGCCGCGGG - Intronic
1142367441 16:89657545-89657567 GCGCGCGAGTCCCCGGAGGACGG + Intronic
1142395407 16:89828773-89828795 GCGCGGGAGCCCGAGGCCGCGGG + Exonic
1142400922 16:89858435-89858457 GCACGCGGGGCCGCGGGCGCTGG - Exonic
1142547398 17:714537-714559 GCTGGGGAGGCCGCGGCGGGTGG - Intronic
1142670579 17:1485849-1485871 GCGCGGGAGGCGGGGGAGGCCGG - Intronic
1142752798 17:1998512-1998534 GCGCGCTGGGCAGCGGTGGCCGG - Intronic
1142762424 17:2050234-2050256 CCGGGCGCGGCGGCGGCGGCCGG + Intergenic
1142836698 17:2593233-2593255 GCGCGAGAGGCAGCGGGGCCCGG - Intronic
1142876398 17:2853932-2853954 GCGCGCGGAGCCGGGGCTGCGGG + Intronic
1143478722 17:7217152-7217174 GGGGGCCTGGCCGCGGCGGCGGG + Exonic
1143635772 17:8163041-8163063 GCGAGCGGGGCCGCGGGGGCGGG + Intronic
1144840637 17:18183785-18183807 GCGCGCGGAGCCGCGGTGGCCGG + Intronic
1145327224 17:21842494-21842516 GCGCAAAAAGCCGCGGCGGCGGG - Intergenic
1145327317 17:21842828-21842850 GCGCAAAAAGCCGCGGCGGCGGG - Intergenic
1145846254 17:28041708-28041730 GGGGGCGGGGCCTCGGCGGCTGG + Intergenic
1146058653 17:29593410-29593432 CCTCGCGAGGCGGCGGCGGCGGG - Intronic
1146126538 17:30235827-30235849 GAGCGCGGAGCCGCGGCCGCGGG - Exonic
1146895184 17:36535485-36535507 GCGCGGGAGGCGGAAGCGGCTGG + Intronic
1147110439 17:38257359-38257381 GCGTGCGCGGCCCCGCCGGCCGG + Intergenic
1147264087 17:39224829-39224851 GGACGCGAGGCCGCGGCCGGGGG - Intronic
1147896568 17:43755386-43755408 GGGCGCGGGGCCGCGGCTTCCGG + Exonic
1147970838 17:44218693-44218715 GCGCGCGCGGCCACGGAAGCGGG + Intronic
1148419067 17:47531072-47531094 GCGTGCGCGGCCCCGCCGGCCGG - Exonic
1148786837 17:50149733-50149755 GGGCGGGCGGCGGCGGCGGCGGG + Exonic
1148825212 17:50388072-50388094 GCGGGAGAGGCAGCGGCGGCTGG - Exonic
1149915036 17:60600652-60600674 GCCGGCGAGGCCCCGGCGTCCGG - Exonic
1150002664 17:61451661-61451683 GGGTGCGGGGCGGCGGCGGCAGG - Intergenic
1150133322 17:62680732-62680754 GCACGCCAGGCCCCGGAGGCGGG - Intronic
1150310992 17:64129683-64129705 GCGCCCGAGCCCGCGGGGTCCGG + Intronic
1150423286 17:65056950-65056972 GCGCGCCCGGCCGCGGCTGCGGG - Intergenic
1150692747 17:67378853-67378875 GCGCGCGAGCCGGGAGCGGCGGG + Intronic
1150788310 17:68180134-68180156 GCGCAGGAGCCCACGGCGGCGGG - Intergenic
1151296904 17:73192823-73192845 GCGGGCGCGGGCGCGGGGGCGGG - Intronic
1151296912 17:73192841-73192863 GGGCGCGAGGGGGCGGGGGCGGG - Intronic
1151414573 17:73952898-73952920 GGGGGCGCGGCCGCGGCGTCCGG - Intergenic
1151919145 17:77140867-77140889 GCGTGCGCGGCCGCGGCCGAGGG - Intronic
1151938872 17:77280959-77280981 CCGGGCGAGGCGGCGGCGCCGGG - Intronic
1152122504 17:78427332-78427354 GCGCTCATGGCCGCGGCTGCAGG - Intronic
1152222210 17:79075061-79075083 GCGGCCGCGGCGGCGGCGGCCGG + Exonic
1152245525 17:79182982-79183004 GCGCGGGAGGGGGCGGCGGGCGG - Intronic
1152280057 17:79379919-79379941 GCGGGAGAGGCCGCGGCAGGAGG - Intronic
1152362539 17:79839348-79839370 GGGCGAGCGGCGGCGGCGGCGGG - Exonic
1152628501 17:81399330-81399352 GCGCGCGGGGCCCCGGGTGCTGG + Intronic
1152708932 17:81860584-81860606 GCGCGCGCGGGCGGGGGGGCAGG - Exonic
1152785386 17:82245297-82245319 GCGCGCGTGGCCGCCGAGGAGGG + Intronic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1152817839 17:82418675-82418697 GGCCGCGAGGGCGGGGCGGCCGG + Exonic
1203192018 17_KI270729v1_random:199254-199276 CCGCAAGAAGCCGCGGCGGCGGG - Intergenic
1203192142 17_KI270729v1_random:199763-199785 GCGCGAAAAGCCGCGGGGGCGGG - Intergenic
1153051921 18:908167-908189 GCGCGCGCCCCCTCGGCGGCCGG - Intronic
1153201799 18:2655356-2655378 GGTCGCGTGGACGCGGCGGCGGG - Intergenic
1153935057 18:9914027-9914049 GTGCGCGTGGCCGTGGCGGCTGG + Intronic
1154241563 18:12657973-12657995 GCGCGCGCGGCCGCGTTGGGCGG - Exonic
1154266477 18:12883553-12883575 GCGAGCCGGGCCGCGGCGTCCGG - Intronic
1155654571 18:28178001-28178023 GCGAGGGCGGCGGCGGCGGCGGG - Intergenic
1156698820 18:39799341-39799363 GGGCGGGAGGGGGCGGCGGCGGG + Intergenic
1157464293 18:47930773-47930795 GTGCGTGGCGCCGCGGCGGCCGG - Intronic
1157752781 18:50194185-50194207 TGGCGTGAGGGCGCGGCGGCTGG - Intronic
1157867052 18:51196767-51196789 GCGGCCGCGGCGGCGGCGGCGGG - Exonic
1158954697 18:62526613-62526635 GGGTGCGCGGCGGCGGCGGCGGG - Intronic
1159798061 18:72867662-72867684 GCGCGGGAGGCGGCGGTCGCAGG + Exonic
1160025083 18:75209707-75209729 GCGCGTGCGGCAGCGGCGGCAGG - Intergenic
1160204620 18:76822669-76822691 GGGCGCGAGGGCGCGGCCGCGGG - Intronic
1160500716 18:79400131-79400153 GCGCGCGAGGGGGCGGGGGCGGG + Intronic
1160673196 19:375985-376007 GAGAGTGAGGCCGCGGGGGCTGG - Exonic
1160725626 19:616695-616717 GCACGCGAGGCCGCCGCCGGGGG - Exonic
1160736136 19:663194-663216 GCGTGCGCGGGCGCGTCGGCCGG - Exonic
1160738810 19:676605-676627 GGGGGCGCGGCGGCGGCGGCGGG + Intronic
1160767026 19:813247-813269 GCGCGCGGGGCCGCCGCCGCTGG - Exonic
1160858815 19:1229114-1229136 CCGCACGGGGCCTCGGCGGCGGG - Exonic
1160871700 19:1280755-1280777 GAGCGGGGGGCGGCGGCGGCTGG - Intergenic
1160902961 19:1438334-1438356 GCGCGCACGGCCGAGGGGGCGGG + Intergenic
1161089165 19:2351740-2351762 GCGCGTGAGGCCCCGGTGGAAGG + Intronic
1161203629 19:3029164-3029186 GCGAGGGCGGCCGCGGCAGCCGG + Exonic
1161265156 19:3360341-3360363 GCGCGCGCGGCAGCGGGGCCGGG - Intronic
1161350085 19:3786426-3786448 GCGCCGGGGGCCGCGGAGGCGGG - Intronic
1161438726 19:4279093-4279115 GGGGCCGAGGCCGCGGCAGCTGG - Exonic
1161450699 19:4343849-4343871 GCGGAGGAGGCGGCGGCGGCGGG + Exonic
1162430510 19:10625599-10625621 GCGCGGGCGGCCGCCGGGGCTGG + Exonic
1162535828 19:11262452-11262474 GGGCCCGGGGCGGCGGCGGCGGG - Exonic
1162918744 19:13888291-13888313 GCGTTCCAGGACGCGGCGGCTGG + Intronic
1163287114 19:16355764-16355786 GCTGGCGCGGCTGCGGCGGCAGG - Exonic
1163586949 19:18169339-18169361 GCGCCGGAGGCTGCGGCGGCGGG + Exonic
1163708635 19:18832402-18832424 GCGGGCGCGGGCGCTGCGGCGGG + Exonic
1163743890 19:19033488-19033510 CCTCGCGCGGCGGCGGCGGCGGG - Intronic
1164693520 19:30227446-30227468 GTGCGGGTGGCAGCGGCGGCCGG + Intergenic
1164958425 19:32406035-32406057 GGGGGCGCGGCCGCGGCGTCGGG + Intronic
1165061442 19:33207058-33207080 GCGGCCGAGGCGGCGGCGGGAGG - Exonic
1165721491 19:38082425-38082447 CTGCGCGGGGCCTCGGCGGCGGG + Exonic
1165924893 19:39320820-39320842 CGGAGCGAGGCAGCGGCGGCGGG - Intergenic
1166052048 19:40266175-40266197 GGGCGCGAGGCAGCGCCAGCTGG + Intronic
1166219133 19:41353903-41353925 GCGCGAAGGGCGGCGGCGGCGGG + Exonic
1166888257 19:45973957-45973979 GCGCGGGCGGCGGCGGCGACGGG + Intergenic
1167129153 19:47573082-47573104 GCGCGCGAGCCCCCGGGGGCGGG - Intergenic
1167369655 19:49072835-49072857 GCGCGGGCGGCGGCGGCGGCGGG - Exonic
1167643660 19:50694961-50694983 GCGCGGGGGGCGGCTGCGGCAGG + Intronic
1168064006 19:53909323-53909345 CCGAGTGAGGCCGCGGCCGCGGG + Exonic
1168297347 19:55383862-55383884 GGGCGCTGGCCCGCGGCGGCGGG + Exonic
1202683795 1_KI270712v1_random:31150-31172 GGGCGAAAAGCCGCGGCGGCGGG - Intergenic
925068869 2:950894-950916 GCGGGCGCGGACGCGGCGCCTGG + Exonic
925609790 2:5693143-5693165 GCGCGGCCGGCGGCGGCGGCGGG + Exonic
926285291 2:11482924-11482946 AGGAGCGGGGCCGCGGCGGCCGG + Intergenic
930089538 2:47521600-47521622 GAGCGCGGAGCCGCGGCGGAAGG + Exonic
932180712 2:69643742-69643764 GCGCGCGGGGGAGGGGCGGCGGG - Intronic
932567356 2:72918150-72918172 GCGCCCGCGGCGGCCGCGGCAGG - Exonic
933772674 2:85754157-85754179 GCGCGCGAGGCAGGGGCGTGGGG - Exonic
933858579 2:86441903-86441925 CCGCGCGAGGACGCGGCCCCGGG - Intronic
934079021 2:88452174-88452196 GCGGGCGAGGCGGGCGCGGCGGG + Exonic
934261137 2:91477897-91477919 GCGCAGAAAGCCGCGGCGGCGGG - Intergenic
934970674 2:98761641-98761663 GCTGGCGTGGCAGCGGCGGCGGG - Intergenic
937045003 2:118846593-118846615 GCGCCCGCGCCGGCGGCGGCTGG + Exonic
937325800 2:120989020-120989042 GCGATGGAGGCCGTGGCGGCAGG + Exonic
938406243 2:131034874-131034896 GCGGGGGCGGCGGCGGCGGCGGG - Intronic
938518395 2:132038708-132038730 GCGCAAAAAGCCGCGGCGGCGGG + Intergenic
938727296 2:134120154-134120176 GCGCCCGGGGCCGCCGCCGCGGG - Intronic
941686842 2:168456305-168456327 GCGGAGGAGGCGGCGGCGGCGGG + Exonic
941951495 2:171160834-171160856 GCCCGGGAGGCGGCGGCGGCGGG + Intronic
942151066 2:173076161-173076183 GCCCGCCCGGCGGCGGCGGCCGG + Intronic
942248102 2:174025751-174025773 GCGCACGCGGCCCCGGCAGCTGG - Intergenic
942454758 2:176130120-176130142 CGGCGCGAAGCCGAGGCGGCGGG + Exonic
943624222 2:190180793-190180815 GCGGGCGCGGCGGCGACGGCAGG + Intronic
945891602 2:215436199-215436221 GCGCGGTCGGCTGCGGCGGCCGG - Intergenic
946019856 2:216633600-216633622 GCGCGAGTGGCGGCGGCGGCGGG + Exonic
947593080 2:231395970-231395992 GCGGGCGCGGCGGCGGCGGCGGG + Intronic
947632308 2:231662151-231662173 GCCCGCGAGGCGGCCACGGCCGG + Intergenic
948046697 2:234951478-234951500 AGGCGCGAGGCTGCGGGGGCCGG - Intergenic
948116035 2:235494632-235494654 GGGCGCGGGGCGGCGGCGGCGGG + Exonic
948824633 2:240568370-240568392 GGGCGCGGGGCCGGGGCGCCGGG - Intronic
949004291 2:241636828-241636850 GGGCGCCGGGCCTCGGCGGCCGG - Intronic
1168750597 20:278917-278939 GCGCGCGAGTGCGCGGAGGGAGG + Intronic
1168804339 20:663647-663669 GGGCGCGAGGGCGAGGCGGAAGG + Exonic
1168878170 20:1185312-1185334 GAGGGCGAGGCGGTGGCGGCCGG - Intronic
1169673783 20:8132446-8132468 GCGCGCGGGGGCGCAGCGCCCGG - Intronic
1172015426 20:31870255-31870277 CAGCGCCGGGCCGCGGCGGCCGG + Intronic
1172118436 20:32584541-32584563 GCGCGCGCGGCGGCCGCGGGCGG - Intronic
1172252487 20:33489868-33489890 GCGCGTGACGCCGAGGGGGCAGG + Intergenic
1172421870 20:34825220-34825242 GCGCTGGAGGGAGCGGCGGCCGG - Intronic
1172529312 20:35619120-35619142 GGGCGCGGGGGCGCGGGGGCTGG - Intronic
1173626354 20:44475884-44475906 GCGCGAGAGGCCGGGCAGGCCGG + Exonic
1175358533 20:58389245-58389267 GAGGGCGAGGCCGCGGTGCCCGG - Exonic
1175873681 20:62219900-62219922 GCGGGCGAGGCGGCGGCGGCGGG - Exonic
1175894714 20:62330979-62331001 GCGGCCGAGGGCCCGGCGGCAGG - Intronic
1176547679 21:8208658-8208680 ACGGGCGAGGCCGGGGCGACGGG - Intergenic
1176547956 21:8209464-8209486 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1176548987 21:8213474-8213496 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1176550165 21:8217358-8217380 CGGCGCGCGGCGGCGGCGGCGGG + Intergenic
1176555576 21:8252864-8252886 ACGGGCGAGGCCGGGGCGACGGG - Intergenic
1176555850 21:8253679-8253701 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1176556880 21:8257686-8257708 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1176566887 21:8392499-8392521 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1176567916 21:8396504-8396526 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1176574506 21:8435892-8435914 ACGGGCGAGGCCGGGGCGACGGG - Intergenic
1176574787 21:8436713-8436735 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1176575820 21:8440723-8440745 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1176577007 21:8444628-8444650 CGGCGCGCGGCGGCGGCGGCGGG + Intergenic
1176611118 21:8987184-8987206 ACGGGCGAGGCCGGGGCGACGGG - Intergenic
1176611401 21:8988006-8988028 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1176952536 21:15064538-15064560 TCGCGGGGGGCCGGGGCGGCGGG - Intronic
1179882744 21:44300301-44300323 GGGCGGGAGGCCGGGGCGGGAGG - Intronic
1180559232 22:16601992-16602014 GCGGCGGCGGCCGCGGCGGCGGG + Intergenic
1180733710 22:18000874-18000896 GAGGGCCAGGCCGCGGAGGCAGG + Intronic
1180843633 22:18970427-18970449 GCGCGGGAGGCGGCGGCGGGCGG - Intergenic
1180962110 22:19766760-19766782 GCGGCGGCGGCCGCGGCGGCTGG - Exonic
1181283400 22:21735754-21735776 GCCCGCGGGGCGGCGGCGGGAGG - Exonic
1181831672 22:25564961-25564983 GCGCGGCGGGCGGCGGCGGCGGG + Exonic
1182445474 22:30387180-30387202 GGGCCCGGGGCCGCGGCGGACGG - Exonic
1182567683 22:31212306-31212328 GCGCCTGAGGCGGCGGCGGCAGG + Intronic
1183093687 22:35540324-35540346 GCGCGTGGGGCCGGGGCCGCTGG - Intergenic
1183545914 22:38454884-38454906 GCGGGCGGGGCCGGAGCGGCGGG + Intronic
1183702155 22:39457063-39457085 CGGCGCGGGGCGGCGGCGGCCGG + Intergenic
1183788406 22:40045198-40045220 GCGCGCGGGGCTGGTGCGGCCGG + Intronic
1184004753 22:41699866-41699888 GCCCGAGAGGCCGCTGCGGCCGG - Intronic
1184131629 22:42519882-42519904 GCGGGCGGGGCCGGGGAGGCGGG - Intergenic
1184141847 22:42582097-42582119 GCGGGCGGGGCCGGGGAGGCGGG - Intergenic
1184411958 22:44331084-44331106 CCGCGCCGGGACGCGGCGGCCGG - Intergenic
1184593945 22:45503103-45503125 GAGCGCGAGGCCGAGGGGGTCGG - Intronic
1184680709 22:46071117-46071139 GCCCGCGCGGCCGAGGCGGGCGG - Intronic
1184680781 22:46071328-46071350 GCGCGCGCGGGCGGGGCGGGCGG - Intronic
1185272696 22:49936096-49936118 GAGCGCGGGGCCGGGGCGGCGGG - Intergenic
1185278622 22:49960654-49960676 GCCCGCGAGGCGGCGGCGGCCGG - Exonic
1185278856 22:49961379-49961401 GCACGGGCGGCGGCGGCGGCGGG + Intronic
1185384667 22:50526279-50526301 GGGCGCGAGGCAGCAGCTGCCGG + Exonic
1203252553 22_KI270733v1_random:124943-124965 ACGGGCGAGGCCGGGGCGACGGG - Intergenic
1203252835 22_KI270733v1_random:125764-125786 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1203253871 22_KI270733v1_random:129781-129803 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1203260609 22_KI270733v1_random:170029-170051 ACGGGCGAGGCCGGGGCGACGGG - Intergenic
1203260891 22_KI270733v1_random:170850-170872 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1203261927 22_KI270733v1_random:174860-174882 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
949895887 3:8767439-8767461 GCGCCAGAGGGCGCGGCGGCTGG - Exonic
949987811 3:9553640-9553662 GCGCGCGAGGCTGCGGCCGCGGG + Intronic
950168055 3:10816317-10816339 GCGCGGGAGTCCGAGGCGCCGGG + Exonic
950215321 3:11154584-11154606 GGGAGCGGGGCCGCCGCGGCTGG + Intronic
950710558 3:14810593-14810615 GCGAGCGCGGGGGCGGCGGCTGG - Intergenic
950902999 3:16513711-16513733 GGACGCGCGGCGGCGGCGGCGGG - Intronic
950940326 3:16884923-16884945 GCGGCCGAGGCGGCGGCGGGAGG + Intronic
951907968 3:27722202-27722224 GTGCGCGAGGCGGCAGCGGCGGG - Exonic
952867232 3:37862128-37862150 GCGCGCGGGGGCGCGGCGCGGGG - Intronic
953326120 3:42013738-42013760 GGGCGCGCGGGGGCGGCGGCCGG - Intergenic
954632862 3:52056480-52056502 GGCCGGGAGGCCGGGGCGGCGGG - Exonic
954632916 3:52056608-52056630 GGGGGCGGGGCCGCGGGGGCCGG + Intergenic
959085817 3:101849746-101849768 GCGCCCGGGGCGGCGGCGGGCGG - Exonic
961365177 3:126395026-126395048 GGGCGCGTGGGGGCGGCGGCAGG + Intronic
963091396 3:141486926-141486948 GGGGGCGGGGCCGCGGCGGGCGG + Intergenic
964118866 3:153162246-153162268 GCGCGATGGGCCGCGGCGGTGGG + Intergenic
965590359 3:170356806-170356828 CCGGGCGAGGCCGGGGCCGCCGG + Intergenic
967852528 3:194093195-194093217 GTGGGAGAGGCCGCGGCGGTGGG - Intergenic
967930290 3:194686101-194686123 GAGCGCGAGTCCCCGGCGTCCGG + Intergenic
968514951 4:1011966-1011988 GCGCGCGCGGCCGCGACCCCAGG + Intronic
968636614 4:1684270-1684292 GCGAGCGGGGCCTGGGCGGCCGG - Intronic
968653064 4:1767550-1767572 GGGCGCGAGGCCGCCGGGTCGGG + Intergenic
968674602 4:1870979-1871001 GGGCGCGCGGCCGCGGAGGCTGG - Intergenic
968701281 4:2059347-2059369 GGGCGCGGGGCGGAGGCGGCGGG - Intergenic
969378909 4:6782174-6782196 GCGCGCGAGCCCGGGAAGGCGGG + Intronic
969413355 4:7043478-7043500 TCGTGCGCGGCGGCGGCGGCGGG + Exonic
970456346 4:16226983-16227005 GCTGGCGCGGCCGCGGCGGCGGG + Intronic
970585708 4:17512174-17512196 GCGCGCTAGGCGGCAGCAGCGGG - Exonic
972396622 4:38663991-38664013 GCGCGGGAGGCGGGGGTGGCGGG + Intergenic
972533139 4:39977853-39977875 GTGCGCGAGGCCCCGGCTCCCGG - Exonic
972671445 4:41216400-41216422 GCGGTGGAGTCCGCGGCGGCGGG + Intronic
972817014 4:42656468-42656490 GCGCCGGAGGCAGGGGCGGCGGG + Intronic
973246743 4:48017374-48017396 GCGCCCGGGGCCGCGGGGGTGGG + Intronic
973339142 4:48986330-48986352 GCCCGGGAGGACGCGGCGGCGGG + Exonic
975689421 4:76949637-76949659 GCGCGCCCGGCCGCGGTGGTGGG - Intergenic
975779057 4:77819920-77819942 GCGCCGGCGGCCGCGGCCGCGGG - Intergenic
976390017 4:84497706-84497728 GCCCGGGCGGCGGCGGCGGCGGG + Exonic
977810040 4:101347422-101347444 GCGCGGGCGATCGCGGCGGCGGG - Exonic
977885728 4:102250372-102250394 GCGCAGGAGCCCGCGGCTGCGGG + Intergenic
981550574 4:145937665-145937687 GCGGGCGAGGCGGGAGCGGCTGG - Intronic
983792298 4:171813286-171813308 GGACGCGAGGCAGCGGCGGAGGG - Intronic
984146344 4:176065936-176065958 GCGCCCGGGGGCGGGGCGGCCGG - Intronic
985129092 4:186723873-186723895 GCGGGCGGGGCCGGGGCGGAGGG - Intronic
986315357 5:6583201-6583223 GAACGCGGGGCCGCGGGGGCTGG + Intergenic
987050591 5:14144176-14144198 ACCCGCGAAGCCGCGGCTGCCGG - Intronic
989577349 5:43000615-43000637 GCGAGGGAGGCTGCGGGGGCGGG - Intergenic
990347448 5:54884128-54884150 GGACGCGGGGCCGCCGCGGCGGG - Intergenic
991707197 5:69369495-69369517 GCGCCCGAAGCCGTCGCGGCGGG - Exonic
994083331 5:95731560-95731582 GCGCGCGAGGGGGACGCGGCCGG + Exonic
996978290 5:129460361-129460383 GGGCGAGAAGCCGCGGCCGCGGG + Exonic
997177745 5:131796850-131796872 GCGCGCCCGGCCGCGACGCCCGG - Exonic
997965518 5:138353008-138353030 GCACTCGAGGCCGGGGCTGCGGG + Intronic
998018806 5:138753287-138753309 GCGGGCGGGGCGGCGGCGGGAGG + Intronic
999300127 5:150485911-150485933 GCTCCGGAGGCCGGGGCGGCCGG - Intronic
1001906583 5:175478540-175478562 ACGCGCGAGGACGCCGTGGCGGG + Exonic
1001906705 5:175478921-175478943 GCGCGCGGGGACGCGGCGGAGGG - Intronic
1002180056 5:177426683-177426705 GCGCGGCTGGCTGCGGCGGCCGG + Intronic
1002211158 5:177600147-177600169 GCCCGGGAGGCCGGGCCGGCCGG + Exonic
1002512751 5:179733365-179733387 AGGCGCGGGGCCGGGGCGGCGGG - Exonic
1002532839 5:179858928-179858950 AGGGGCGGGGCCGCGGCGGCCGG - Intronic
1002541316 5:179908004-179908026 GCGCCCGAGGCCGGGGCTGAGGG - Intergenic
1002691371 5:181053004-181053026 GCGCGCGCGGCGGAGGGGGCGGG - Intronic
1002691381 5:181053028-181053050 GCGCGCGCGGCGGAGGGGGCGGG - Intronic
1002888176 6:1313431-1313453 CGGGGCGAGGCCGGGGCGGCGGG - Exonic
1003942729 6:11044529-11044551 GCGCGCGAGGCCGCAGGGGCGGG - Intergenic
1004272899 6:14211170-14211192 GAGCGGGAGCCCGCGGGGGCGGG - Intergenic
1004694289 6:18019753-18019775 GCGCAGGAGCCCACGGCGGCGGG + Intergenic
1005327890 6:24720278-24720300 GCGGAAGAGGCGGCGGCGGCGGG + Exonic
1005554181 6:26956623-26956645 GCGCGGGAGCCCGCGGCTGGGGG + Intergenic
1006851629 6:37102768-37102790 GGGCGAGGGGCCGGGGCGGCCGG - Intergenic
1007444514 6:41895023-41895045 GCGCCCGGGGCGGGGGCGGCGGG - Intronic
1010703128 6:79077105-79077127 GCGCGAGAGTCGGCGGCGGCGGG - Intronic
1010703305 6:79077779-79077801 GGGAGGGAGGCGGCGGCGGCGGG - Intronic
1011765036 6:90611122-90611144 GCGCGCGCGGAGGAGGCGGCCGG + Intergenic
1013225734 6:108118478-108118500 GGGCGCACGGCCTCGGCGGCTGG - Intronic
1013366300 6:109440757-109440779 GCGCGGGCGGCCGCGACCGCCGG + Exonic
1013793638 6:113860250-113860272 GCGGGCGAGGAGGGGGCGGCGGG + Exonic
1014778207 6:125534188-125534210 GTGCGCGAGGACGCTGAGGCAGG + Intergenic
1015149089 6:130019279-130019301 GCGAGCGCGGCCGCCGAGGCGGG + Intronic
1015403723 6:132814576-132814598 CCGCGCGACTCGGCGGCGGCAGG - Exonic
1015654167 6:135497952-135497974 GCTCGCGTGGCCGGGGAGGCGGG - Intergenic
1017163955 6:151390921-151390943 GCGCCCTGGGCGGCGGCGGCCGG - Intronic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1017662430 6:156687455-156687477 GCCGCCGAGGCCGCCGCGGCCGG - Intergenic
1018443601 6:163834913-163834935 GCGGGCGAGGCCATGGCTGCAGG - Intergenic
1019111936 6:169724033-169724055 GGGGGCGGGGCCGGGGCGGCGGG - Exonic
1019395812 7:816978-817000 GCGCGGGAGGCCGCGGCGGGCGG + Intronic
1019500382 7:1361583-1361605 GCTCGGGAGGCTGAGGCGGCAGG + Intergenic
1019562565 7:1665874-1665896 GAGCGCGGGGCGGCGGCGGCGGG - Intergenic
1020274306 7:6615525-6615547 GGGCGCGGGGGCGCGGCGGGCGG + Intergenic
1021827940 7:24573354-24573376 GCGCGCGCGGAGGCAGCGGCGGG + Exonic
1022715070 7:32891626-32891648 CCAGGCGAGGCCGCGGCGGGAGG - Exonic
1023955710 7:44885304-44885326 GCGAGCGCGGCGGCGGCGGTGGG - Exonic
1023955788 7:44885572-44885594 GGCCGCGAGGCCGCGGAGGGCGG - Intergenic
1025078665 7:55964463-55964485 GGGCGCGCGGCCGCGGGGGTCGG - Intronic
1025916841 7:65873122-65873144 GCGCGCGCGGGCGCGGAGGGAGG - Intergenic
1026765056 7:73155089-73155111 GCGCGGGGGGCGGCGGCGGCCGG - Intergenic
1027041529 7:74964844-74964866 GCGCGGGGGGCGGCGGCGGCCGG - Exonic
1027082113 7:75237525-75237547 GCGCGGGGGGCGGCGGCGGCCGG + Intergenic
1027592767 7:80135546-80135568 AGGCGCGAGTCCGAGGCGGCGGG + Intronic
1029109565 7:98205725-98205747 GCCTGGGAGGCCGCGGCCGCGGG - Exonic
1029390694 7:100272071-100272093 GCGCGGGGGGCGGCGGCGGCCGG + Exonic
1029849330 7:103446067-103446089 GCGCGGGCGGCCGCGGGGCCGGG - Intronic
1030102099 7:105955887-105955909 GCGCAGGAGCCCACGGCGGCGGG + Intronic
1030304152 7:108002601-108002623 CCGCGGGAGGCCGCAGGGGCCGG + Intronic
1031986276 7:128166642-128166664 GCGGTCGAGGGCGCGCCGGCTGG - Intergenic
1032011754 7:128351862-128351884 GCGCGCACGGCCCCGGTGGCGGG - Exonic
1032122856 7:129169295-129169317 GCGCGCGAGGCAGGCGGGGCGGG + Intronic
1032298798 7:130668394-130668416 GCGCGCGCGGGCGCCGGGGCGGG + Intronic
1033300018 7:140177054-140177076 GCGCGCGAGGCCGCGGCGGCTGG + Intergenic
1033814409 7:145054705-145054727 TCGTGCTAGGCCGAGGCGGCTGG + Intergenic
1034197875 7:149262076-149262098 GGGCGCGGGGCGGCGGCCGCGGG + Intergenic
1034494297 7:151410596-151410618 CCGAGGGAGCCCGCGGCGGCTGG - Intronic
1034618015 7:152435837-152435859 GCGGCGGCGGCCGCGGCGGCGGG - Exonic
1034622246 7:152464616-152464638 GCACGCGTGGGCGCGGCGGGTGG - Intergenic
1034977743 7:155457998-155458020 GCGCCGGAGCCCGAGGCGGCCGG + Intergenic
1035187702 7:157139145-157139167 GGCAGCGAGGACGCGGCGGCCGG - Exonic
1036723722 8:11201042-11201064 CCGCGGGAGGCTGCAGCGGCTGG + Exonic
1038035366 8:23682482-23682504 GCGCGCGTGGCTGCGGAGGCGGG + Intronic
1038176373 8:25184830-25184852 GAGCGCGGGGCGGCGGCGGCCGG + Intronic
1041919873 8:63169087-63169109 GGGCGCGGTGCCGCGGCGGGTGG + Intronic
1043388271 8:79768380-79768402 CCGCGCGAGGGCGCGCCGGCGGG + Intergenic
1043502973 8:80874375-80874397 GCGCGCGCGGGCTCGGCCGCCGG - Intronic
1045231405 8:100310161-100310183 GCGCGCTGGGGCGGGGCGGCCGG - Intronic
1048553901 8:135457360-135457382 GCGCGGCAGGGCGGGGCGGCGGG + Intergenic
1048981174 8:139703924-139703946 GCGGGCGCGGCGGCGGCGGCGGG + Intergenic
1049145699 8:141000407-141000429 GCCCGCGAGGCCGCGCCCGGGGG + Intronic
1049157281 8:141074873-141074895 GTCCGCGAGGCCGGGACGGCCGG + Intergenic
1049212182 8:141391917-141391939 GGGCGCGCGGCCGCGGCGTGGGG + Intergenic
1049532253 8:143160365-143160387 GCGCGGGGGGCGGGGGCGGCTGG + Intronic
1049558723 8:143296838-143296860 GGGCGCGAGGCCGAGGCCGGGGG + Exonic
1049645333 8:143733518-143733540 GTGCGCGGGGCCGGGGTGGCGGG - Intronic
1053157595 9:35791665-35791687 GCGCGCGGGGCCCAGGCGGGGGG + Intergenic
1054407310 9:64773676-64773698 GCGCAAAAAGCCGCGGCGGCGGG + Intergenic
1054835561 9:69672240-69672262 GCGCTGGAGGCAGCAGCGGCTGG - Exonic
1055945715 9:81689506-81689528 GCGCGGGCGGCGGCGGCGGTGGG - Intergenic
1056154049 9:83817558-83817580 GCGGGAGAGGCGGCGGCGGGGGG - Exonic
1056356448 9:85805535-85805557 GCGGGAGAGGCGGCGGCGGGGGG + Intergenic
1056773946 9:89498075-89498097 GCGCGCGAGAGCGCTGAGGCCGG + Intronic
1057592427 9:96383771-96383793 GCGCCCGAGGCCGGCGCGGGAGG + Intergenic
1057596128 9:96417671-96417693 GCGGCGGAGGCCGAGGCGGCGGG + Exonic
1057881530 9:98796304-98796326 GGGCCCGGGGCCGCAGCGGCGGG - Exonic
1058851218 9:109013507-109013529 CCGCCCGAGGCGGCGGCGACAGG + Exonic
1060544761 9:124453387-124453409 GCGCGCTGGGGCGCGGGGGCTGG + Exonic
1062022576 9:134326389-134326411 GGGCGCGGGCGCGCGGCGGCGGG + Intronic
1062491675 9:136807979-136808001 GCGCCGGAGGCCGCGGGGGCCGG + Exonic
1062499628 9:136846800-136846822 GCGCGCGAGCTGGCGGCCGCTGG + Exonic
1062592082 9:137278717-137278739 GCTCGGGGGGCCGCGGCAGCAGG - Exonic
1062595143 9:137295963-137295985 GCGCGCCAGGCGGGGACGGCGGG - Intergenic
1062653692 9:137591015-137591037 GCGCGGGAGGCCGCGCCCTCCGG - Intergenic
1203468957 Un_GL000220v1:108094-108116 ACGGGCGAGGCCGGGGCGACGGG - Intergenic
1203469238 Un_GL000220v1:108915-108937 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1203470271 Un_GL000220v1:112925-112947 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1203476778 Un_GL000220v1:152066-152088 ACGGGCGAGGCCGGGGCGACGGG - Intergenic
1203477059 Un_GL000220v1:152887-152909 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1203478092 Un_GL000220v1:156897-156919 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1203616832 Un_KI270749v1:73377-73399 GCGGGAAAGACCGCGGCGGCAGG - Intergenic
1187173160 X:16870609-16870631 GCGCGCGAGGGCGGGGCTGATGG + Intergenic
1189331011 X:40145277-40145299 CCGCGCGAACCCGCGGCGCCCGG + Intronic
1189446478 X:41085605-41085627 GAGAGAGAGGCGGCGGCGGCGGG - Intergenic
1190246927 X:48696886-48696908 GCGTCCGAGGCCCCGGCGCCGGG + Intronic
1190712861 X:53082244-53082266 GCGATCGCCGCCGCGGCGGCCGG + Intergenic
1195923236 X:110002825-110002847 GCGCGGGAGGTTGCGGCGCCGGG + Intronic
1197873548 X:131082390-131082412 GCGGGCGCGGGGGCGGCGGCAGG + Intronic
1198450955 X:136767083-136767105 GCGCGCGAGGGCCCGGGGGTGGG - Intronic
1200128999 X:153830913-153830935 GCGAGCGCGCCCACGGCGGCGGG + Intergenic
1200209668 X:154341657-154341679 GCGCGGGAGGGCGCGGCCGTGGG - Intergenic
1200221184 X:154390435-154390457 GCGCGGGAGGGCGCGGCCGTGGG + Intronic
1200239401 X:154486035-154486057 GGGCGCGAGGCCGCCTCGGGCGG + Intronic
1200249882 X:154547175-154547197 GCGCGCGAGGCCGCCGGGGCAGG - Exonic
1200306069 X:155027084-155027106 GCGCGCGCGGCCGGCGCCGCGGG + Intronic