ID: 1033300084

View in Genome Browser
Species Human (GRCh38)
Location 7:140177312-140177334
Sequence CGCAGCCGGAGGAGGACGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033300069_1033300084 23 Left 1033300069 7:140177266-140177288 CCCGTGAGGACACGCGCGGTGGT No data
Right 1033300084 7:140177312-140177334 CGCAGCCGGAGGAGGACGGCGGG No data
1033300067_1033300084 24 Left 1033300067 7:140177265-140177287 CCCCGTGAGGACACGCGCGGTGG No data
Right 1033300084 7:140177312-140177334 CGCAGCCGGAGGAGGACGGCGGG No data
1033300070_1033300084 22 Left 1033300070 7:140177267-140177289 CCGTGAGGACACGCGCGGTGGTG No data
Right 1033300084 7:140177312-140177334 CGCAGCCGGAGGAGGACGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033300084 Original CRISPR CGCAGCCGGAGGAGGACGGC GGG Intergenic