ID: 1033302221

View in Genome Browser
Species Human (GRCh38)
Location 7:140196671-140196693
Sequence TCAAAGTAAGAAAGCAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033302221_1033302226 27 Left 1033302221 7:140196671-140196693 CCTCTTTTGCTTTCTTACTTTGA No data
Right 1033302226 7:140196721-140196743 GTCCTGTGGAGAGGCCCACATGG No data
1033302221_1033302225 18 Left 1033302221 7:140196671-140196693 CCTCTTTTGCTTTCTTACTTTGA No data
Right 1033302225 7:140196712-140196734 CTGTGAGATGTCCTGTGGAGAGG No data
1033302221_1033302224 13 Left 1033302221 7:140196671-140196693 CCTCTTTTGCTTTCTTACTTTGA No data
Right 1033302224 7:140196707-140196729 CCACACTGTGAGATGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033302221 Original CRISPR TCAAAGTAAGAAAGCAAAAG AGG (reversed) Intergenic