ID: 1033302225

View in Genome Browser
Species Human (GRCh38)
Location 7:140196712-140196734
Sequence CTGTGAGATGTCCTGTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033302221_1033302225 18 Left 1033302221 7:140196671-140196693 CCTCTTTTGCTTTCTTACTTTGA No data
Right 1033302225 7:140196712-140196734 CTGTGAGATGTCCTGTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033302225 Original CRISPR CTGTGAGATGTCCTGTGGAG AGG Intergenic
No off target data available for this crispr