ID: 1033304580

View in Genome Browser
Species Human (GRCh38)
Location 7:140215076-140215098
Sequence GGTGCTGCTTAGAACCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033304580_1033304584 6 Left 1033304580 7:140215076-140215098 CCACTGGGGTTCTAAGCAGCACC No data
Right 1033304584 7:140215105-140215127 ACCTATTCTTCTCTTCACAATGG No data
1033304580_1033304586 7 Left 1033304580 7:140215076-140215098 CCACTGGGGTTCTAAGCAGCACC No data
Right 1033304586 7:140215106-140215128 CCTATTCTTCTCTTCACAATGGG No data
1033304580_1033304587 21 Left 1033304580 7:140215076-140215098 CCACTGGGGTTCTAAGCAGCACC No data
Right 1033304587 7:140215120-140215142 CACAATGGGATCTACGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033304580 Original CRISPR GGTGCTGCTTAGAACCCCAG TGG (reversed) Intergenic
No off target data available for this crispr