ID: 1033306736

View in Genome Browser
Species Human (GRCh38)
Location 7:140230813-140230835
Sequence GGGCGGCGACCCCCACGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033306736_1033306747 11 Left 1033306736 7:140230813-140230835 CCGGGCCGTGGGGGTCGCCGCCC No data
Right 1033306747 7:140230847-140230869 GGAACAATGACAGCCCGATGGGG No data
1033306736_1033306751 22 Left 1033306736 7:140230813-140230835 CCGGGCCGTGGGGGTCGCCGCCC No data
Right 1033306751 7:140230858-140230880 AGCCCGATGGGGAAGGGCGGCGG No data
1033306736_1033306745 9 Left 1033306736 7:140230813-140230835 CCGGGCCGTGGGGGTCGCCGCCC No data
Right 1033306745 7:140230845-140230867 GGGGAACAATGACAGCCCGATGG No data
1033306736_1033306746 10 Left 1033306736 7:140230813-140230835 CCGGGCCGTGGGGGTCGCCGCCC No data
Right 1033306746 7:140230846-140230868 GGGAACAATGACAGCCCGATGGG No data
1033306736_1033306748 15 Left 1033306736 7:140230813-140230835 CCGGGCCGTGGGGGTCGCCGCCC No data
Right 1033306748 7:140230851-140230873 CAATGACAGCCCGATGGGGAAGG No data
1033306736_1033306750 19 Left 1033306736 7:140230813-140230835 CCGGGCCGTGGGGGTCGCCGCCC No data
Right 1033306750 7:140230855-140230877 GACAGCCCGATGGGGAAGGGCGG No data
1033306736_1033306740 -10 Left 1033306736 7:140230813-140230835 CCGGGCCGTGGGGGTCGCCGCCC No data
Right 1033306740 7:140230826-140230848 GTCGCCGCCCGAAGTGACCGGGG No data
1033306736_1033306749 16 Left 1033306736 7:140230813-140230835 CCGGGCCGTGGGGGTCGCCGCCC No data
Right 1033306749 7:140230852-140230874 AATGACAGCCCGATGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033306736 Original CRISPR GGGCGGCGACCCCCACGGCC CGG (reversed) Intergenic