ID: 1033306888

View in Genome Browser
Species Human (GRCh38)
Location 7:140231466-140231488
Sequence CACGGCCCGCGGGCTTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033306888_1033306896 17 Left 1033306888 7:140231466-140231488 CCAATGGAAGCCCGCGGGCCGTG No data
Right 1033306896 7:140231506-140231528 ACGTTTATGGTGTCCCGGCCCGG No data
1033306888_1033306893 4 Left 1033306888 7:140231466-140231488 CCAATGGAAGCCCGCGGGCCGTG No data
Right 1033306893 7:140231493-140231515 CTTGCCACTAGAAACGTTTATGG No data
1033306888_1033306895 12 Left 1033306888 7:140231466-140231488 CCAATGGAAGCCCGCGGGCCGTG No data
Right 1033306895 7:140231501-140231523 TAGAAACGTTTATGGTGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033306888 Original CRISPR CACGGCCCGCGGGCTTCCAT TGG (reversed) Intergenic
No off target data available for this crispr