ID: 1033308179

View in Genome Browser
Species Human (GRCh38)
Location 7:140239901-140239923
Sequence CTGGGTGATCCCTGGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033308179_1033308193 12 Left 1033308179 7:140239901-140239923 CCCTGCACCCAGGGATCACCCAG No data
Right 1033308193 7:140239936-140239958 TATGGTGGGTTTGTCAAGGGGGG No data
1033308179_1033308183 -6 Left 1033308179 7:140239901-140239923 CCCTGCACCCAGGGATCACCCAG No data
Right 1033308183 7:140239918-140239940 ACCCAGCAAAGCCAGAGCTATGG No data
1033308179_1033308186 -3 Left 1033308179 7:140239901-140239923 CCCTGCACCCAGGGATCACCCAG No data
Right 1033308186 7:140239921-140239943 CAGCAAAGCCAGAGCTATGGTGG No data
1033308179_1033308192 11 Left 1033308179 7:140239901-140239923 CCCTGCACCCAGGGATCACCCAG No data
Right 1033308192 7:140239935-140239957 CTATGGTGGGTTTGTCAAGGGGG No data
1033308179_1033308190 9 Left 1033308179 7:140239901-140239923 CCCTGCACCCAGGGATCACCCAG No data
Right 1033308190 7:140239933-140239955 AGCTATGGTGGGTTTGTCAAGGG No data
1033308179_1033308194 30 Left 1033308179 7:140239901-140239923 CCCTGCACCCAGGGATCACCCAG No data
Right 1033308194 7:140239954-140239976 GGGGGAAATGCAGCCCTTGATGG No data
1033308179_1033308187 -2 Left 1033308179 7:140239901-140239923 CCCTGCACCCAGGGATCACCCAG No data
Right 1033308187 7:140239922-140239944 AGCAAAGCCAGAGCTATGGTGGG No data
1033308179_1033308189 8 Left 1033308179 7:140239901-140239923 CCCTGCACCCAGGGATCACCCAG No data
Right 1033308189 7:140239932-140239954 GAGCTATGGTGGGTTTGTCAAGG No data
1033308179_1033308191 10 Left 1033308179 7:140239901-140239923 CCCTGCACCCAGGGATCACCCAG No data
Right 1033308191 7:140239934-140239956 GCTATGGTGGGTTTGTCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033308179 Original CRISPR CTGGGTGATCCCTGGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr