ID: 1033310787

View in Genome Browser
Species Human (GRCh38)
Location 7:140260319-140260341
Sequence TCCTGGCCTCCTAGTAAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033310780_1033310787 -5 Left 1033310780 7:140260301-140260323 CCCCTGCAAGGGCCACTCTCCTG No data
Right 1033310787 7:140260319-140260341 TCCTGGCCTCCTAGTAAGGGCGG No data
1033310776_1033310787 10 Left 1033310776 7:140260286-140260308 CCCACTTCACTCGTTCCCCTGCA No data
Right 1033310787 7:140260319-140260341 TCCTGGCCTCCTAGTAAGGGCGG No data
1033310777_1033310787 9 Left 1033310777 7:140260287-140260309 CCACTTCACTCGTTCCCCTGCAA No data
Right 1033310787 7:140260319-140260341 TCCTGGCCTCCTAGTAAGGGCGG No data
1033310783_1033310787 -7 Left 1033310783 7:140260303-140260325 CCTGCAAGGGCCACTCTCCTGGC No data
Right 1033310787 7:140260319-140260341 TCCTGGCCTCCTAGTAAGGGCGG No data
1033310781_1033310787 -6 Left 1033310781 7:140260302-140260324 CCCTGCAAGGGCCACTCTCCTGG No data
Right 1033310787 7:140260319-140260341 TCCTGGCCTCCTAGTAAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033310787 Original CRISPR TCCTGGCCTCCTAGTAAGGG CGG Intergenic
No off target data available for this crispr