ID: 1033313664

View in Genome Browser
Species Human (GRCh38)
Location 7:140280673-140280695
Sequence GGGTTGCAGGTGAAGATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033313664_1033313671 2 Left 1033313664 7:140280673-140280695 CCCACCATCTTCACCTGCAACCC No data
Right 1033313671 7:140280698-140280720 TCTCTTGGTCCTACTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033313664 Original CRISPR GGGTTGCAGGTGAAGATGGT GGG (reversed) Intergenic
No off target data available for this crispr