ID: 1033313821

View in Genome Browser
Species Human (GRCh38)
Location 7:140281804-140281826
Sequence CAAGCTCGGTGTGCACGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033313821_1033313824 2 Left 1033313821 7:140281804-140281826 CCTCTACGTGCACACCGAGCTTG No data
Right 1033313824 7:140281829-140281851 ATGCAGATGTGCTTCAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033313821 Original CRISPR CAAGCTCGGTGTGCACGTAG AGG (reversed) Intergenic
No off target data available for this crispr