ID: 1033314460

View in Genome Browser
Species Human (GRCh38)
Location 7:140285981-140286003
Sequence CACACTGCACACATGGGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033314460_1033314473 24 Left 1033314460 7:140285981-140286003 CCCATTCCCATGTGTGCAGTGTG No data
Right 1033314473 7:140286028-140286050 AACTCTTGTTCTTGGAACCTGGG No data
1033314460_1033314472 23 Left 1033314460 7:140285981-140286003 CCCATTCCCATGTGTGCAGTGTG No data
Right 1033314472 7:140286027-140286049 TAACTCTTGTTCTTGGAACCTGG No data
1033314460_1033314471 16 Left 1033314460 7:140285981-140286003 CCCATTCCCATGTGTGCAGTGTG No data
Right 1033314471 7:140286020-140286042 TGTGGTCTAACTCTTGTTCTTGG No data
1033314460_1033314465 -2 Left 1033314460 7:140285981-140286003 CCCATTCCCATGTGTGCAGTGTG No data
Right 1033314465 7:140286002-140286024 TGGACCAAAGAACCCCCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033314460 Original CRISPR CACACTGCACACATGGGAAT GGG (reversed) Intergenic