ID: 1033314465

View in Genome Browser
Species Human (GRCh38)
Location 7:140286002-140286024
Sequence TGGACCAAAGAACCCCCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033314458_1033314465 4 Left 1033314458 7:140285975-140285997 CCCTGGCCCATTCCCATGTGTGC No data
Right 1033314465 7:140286002-140286024 TGGACCAAAGAACCCCCGTGTGG No data
1033314459_1033314465 3 Left 1033314459 7:140285976-140285998 CCTGGCCCATTCCCATGTGTGCA No data
Right 1033314465 7:140286002-140286024 TGGACCAAAGAACCCCCGTGTGG No data
1033314461_1033314465 -3 Left 1033314461 7:140285982-140286004 CCATTCCCATGTGTGCAGTGTGG No data
Right 1033314465 7:140286002-140286024 TGGACCAAAGAACCCCCGTGTGG No data
1033314463_1033314465 -8 Left 1033314463 7:140285987-140286009 CCCATGTGTGCAGTGTGGACCAA No data
Right 1033314465 7:140286002-140286024 TGGACCAAAGAACCCCCGTGTGG No data
1033314457_1033314465 5 Left 1033314457 7:140285974-140285996 CCCCTGGCCCATTCCCATGTGTG No data
Right 1033314465 7:140286002-140286024 TGGACCAAAGAACCCCCGTGTGG No data
1033314452_1033314465 29 Left 1033314452 7:140285950-140285972 CCTGAAACTCAGCCGACTCCAAG No data
Right 1033314465 7:140286002-140286024 TGGACCAAAGAACCCCCGTGTGG No data
1033314455_1033314465 17 Left 1033314455 7:140285962-140285984 CCGACTCCAAGGCCCCTGGCCCA No data
Right 1033314465 7:140286002-140286024 TGGACCAAAGAACCCCCGTGTGG No data
1033314464_1033314465 -9 Left 1033314464 7:140285988-140286010 CCATGTGTGCAGTGTGGACCAAA No data
Right 1033314465 7:140286002-140286024 TGGACCAAAGAACCCCCGTGTGG No data
1033314456_1033314465 11 Left 1033314456 7:140285968-140285990 CCAAGGCCCCTGGCCCATTCCCA No data
Right 1033314465 7:140286002-140286024 TGGACCAAAGAACCCCCGTGTGG No data
1033314460_1033314465 -2 Left 1033314460 7:140285981-140286003 CCCATTCCCATGTGTGCAGTGTG No data
Right 1033314465 7:140286002-140286024 TGGACCAAAGAACCCCCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033314465 Original CRISPR TGGACCAAAGAACCCCCGTG TGG Intergenic