ID: 1033314471

View in Genome Browser
Species Human (GRCh38)
Location 7:140286020-140286042
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033314461_1033314471 15 Left 1033314461 7:140285982-140286004 CCATTCCCATGTGTGCAGTGTGG No data
Right 1033314471 7:140286020-140286042 TGTGGTCTAACTCTTGTTCTTGG No data
1033314459_1033314471 21 Left 1033314459 7:140285976-140285998 CCTGGCCCATTCCCATGTGTGCA No data
Right 1033314471 7:140286020-140286042 TGTGGTCTAACTCTTGTTCTTGG No data
1033314460_1033314471 16 Left 1033314460 7:140285981-140286003 CCCATTCCCATGTGTGCAGTGTG No data
Right 1033314471 7:140286020-140286042 TGTGGTCTAACTCTTGTTCTTGG No data
1033314457_1033314471 23 Left 1033314457 7:140285974-140285996 CCCCTGGCCCATTCCCATGTGTG No data
Right 1033314471 7:140286020-140286042 TGTGGTCTAACTCTTGTTCTTGG No data
1033314466_1033314471 -9 Left 1033314466 7:140286006-140286028 CCAAAGAACCCCCGTGTGGTCTA No data
Right 1033314471 7:140286020-140286042 TGTGGTCTAACTCTTGTTCTTGG No data
1033314463_1033314471 10 Left 1033314463 7:140285987-140286009 CCCATGTGTGCAGTGTGGACCAA No data
Right 1033314471 7:140286020-140286042 TGTGGTCTAACTCTTGTTCTTGG No data
1033314458_1033314471 22 Left 1033314458 7:140285975-140285997 CCCTGGCCCATTCCCATGTGTGC No data
Right 1033314471 7:140286020-140286042 TGTGGTCTAACTCTTGTTCTTGG No data
1033314464_1033314471 9 Left 1033314464 7:140285988-140286010 CCATGTGTGCAGTGTGGACCAAA No data
Right 1033314471 7:140286020-140286042 TGTGGTCTAACTCTTGTTCTTGG No data
1033314456_1033314471 29 Left 1033314456 7:140285968-140285990 CCAAGGCCCCTGGCCCATTCCCA No data
Right 1033314471 7:140286020-140286042 TGTGGTCTAACTCTTGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033314471 Original CRISPR TGTGGTCTAACTCTTGTTCT TGG Intergenic