ID: 1033319755

View in Genome Browser
Species Human (GRCh38)
Location 7:140328680-140328702
Sequence CAATTTAAGGAGAGGCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 207}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033319748_1033319755 9 Left 1033319748 7:140328648-140328670 CCTGGAAGTAGAAGTAAGCCTAG 0: 1
1: 0
2: 0
3: 13
4: 187
Right 1033319755 7:140328680-140328702 CAATTTAAGGAGAGGCTGCATGG 0: 1
1: 0
2: 3
3: 30
4: 207
1033319747_1033319755 10 Left 1033319747 7:140328647-140328669 CCCTGGAAGTAGAAGTAAGCCTA 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1033319755 7:140328680-140328702 CAATTTAAGGAGAGGCTGCATGG 0: 1
1: 0
2: 3
3: 30
4: 207
1033319745_1033319755 21 Left 1033319745 7:140328636-140328658 CCCAATTTACACCCTGGAAGTAG 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1033319755 7:140328680-140328702 CAATTTAAGGAGAGGCTGCATGG 0: 1
1: 0
2: 3
3: 30
4: 207
1033319752_1033319755 -9 Left 1033319752 7:140328666-140328688 CCTAGGGGAAGAGTCAATTTAAG 0: 1
1: 0
2: 0
3: 13
4: 127
Right 1033319755 7:140328680-140328702 CAATTTAAGGAGAGGCTGCATGG 0: 1
1: 0
2: 3
3: 30
4: 207
1033319746_1033319755 20 Left 1033319746 7:140328637-140328659 CCAATTTACACCCTGGAAGTAGA 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1033319755 7:140328680-140328702 CAATTTAAGGAGAGGCTGCATGG 0: 1
1: 0
2: 3
3: 30
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033319755 Original CRISPR CAATTTAAGGAGAGGCTGCA TGG Intronic
902417204 1:16247208-16247230 CAGTTCATGGAGAGGCTACATGG + Exonic
904472310 1:30743498-30743520 GCACTTAAGTAGAGGCTGCATGG - Intronic
904698485 1:32344175-32344197 GAATTTAAGGAGGGGCTGGGAGG - Intergenic
907691349 1:56669812-56669834 CAAGTTTAGGGGAGGCTTCATGG + Intronic
908275479 1:62466471-62466493 CAATTTATGGATTGGCTCCATGG + Intronic
908421858 1:63966545-63966567 GAAGTTAAGGAAAGGCTGAATGG + Intronic
912078914 1:105911680-105911702 CCATCTCAGGAGAGGCTACAAGG + Intergenic
914381625 1:147121485-147121507 CCAGTGCAGGAGAGGCTGCAAGG - Intergenic
914977540 1:152379978-152380000 CCATCTCAGGGGAGGCTGCAAGG - Intergenic
917696232 1:177526977-177526999 CAATTTAAGAAGGGGTTTCAAGG - Intergenic
919745027 1:201003498-201003520 GAAGTTAGGGTGAGGCTGCAGGG + Intronic
921923726 1:220694826-220694848 CCATCTAAGGAGAGACTGTAGGG + Intronic
922688420 1:227666603-227666625 CTACTCAAGGAGAAGCTGCAAGG - Intronic
923934721 1:238747883-238747905 CCATCTCAGGAGAGGCTGCAAGG + Intergenic
924325973 1:242894135-242894157 CCTTATAAGGAGAGGCAGCAAGG + Intergenic
1063549094 10:7012103-7012125 CAGTTGAAGCAGAGGCTGTATGG - Intergenic
1064003303 10:11681332-11681354 CAATTCAAGCAGGGGTTGCAAGG - Intergenic
1064544519 10:16437201-16437223 GCACTTAAGGAGAGGCGGCAGGG - Intronic
1066058180 10:31700466-31700488 CACTTGATGGAGAGGCTGCCGGG - Intergenic
1067762403 10:49058121-49058143 CAATGGAAGGAGAAGCGGCAGGG - Intronic
1068379287 10:56228723-56228745 AAATATAAAGAGAGGCTGCTTGG + Intergenic
1069599767 10:69696349-69696371 CAATTCACAGAGTGGCTGCAGGG - Intergenic
1070772127 10:79088609-79088631 GGCTTTAAGCAGAGGCTGCAAGG + Intronic
1074643717 10:115419467-115419489 CAGTTAAAAGAGAGGCTGAACGG + Intronic
1075055072 10:119212025-119212047 AAATTGAAGGAGAAGCTTCAGGG - Intronic
1075763784 10:124877007-124877029 CATTTTAAGGAGAGGTTGCTAGG + Intergenic
1076806786 10:132862785-132862807 CAGGTTCAGGAGAGGCTGGAGGG + Intronic
1079277733 11:19057382-19057404 CAGTTTATGGAGAGGATTCAGGG + Intronic
1079815803 11:25056434-25056456 CTATTTACTGAGAGACTGCATGG - Intronic
1082749449 11:57001019-57001041 CCATCTCAGGAAAGGCTGCAAGG - Intergenic
1083486331 11:62984912-62984934 CAAAGTGAGGAGAAGCTGCAAGG - Exonic
1083839287 11:65294567-65294589 CCGTTTATGGAGAGGCTGCAGGG - Exonic
1085022081 11:73216301-73216323 GAATTTAAGGATAGGGTGCAGGG + Intergenic
1085534038 11:77207536-77207558 CCATGTAAGGGGAGGCTGCAGGG - Intronic
1086002899 11:82002064-82002086 CCATCTCAGGAGAGGCTGCAAGG - Intergenic
1086736410 11:90311348-90311370 CATTTTTAGGAGAGGAAGCAAGG + Intergenic
1087470669 11:98570204-98570226 CATTTTAAGTAGAGGGTCCAAGG - Intergenic
1088042368 11:105402844-105402866 CATTTTTAGGAGGGGGTGCAGGG + Intergenic
1088745122 11:112798599-112798621 CAATTTAGGGAGGGGCTACCTGG + Intergenic
1088936540 11:114406704-114406726 CAATTAAAGGTAAGGCTACAGGG - Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1091773398 12:3168475-3168497 GAGTCTAAGAAGAGGCTGCAAGG + Intronic
1092943393 12:13431107-13431129 CAAATTAAGGGGAGGCAGCTGGG - Intergenic
1093369937 12:18354452-18354474 CCATCTCAGGAGAGGCTGCAAGG - Intronic
1094010535 12:25804359-25804381 CCATTTGAAGAGAAGCTGCAAGG - Intergenic
1097077930 12:56408913-56408935 CCATCTCAGGAGAGGCTGCAAGG - Intergenic
1097747443 12:63316372-63316394 CCATCTCAGGAGAGGCTGCACGG - Intergenic
1100208439 12:92376392-92376414 CAAGTTCTGGAGAGGCTTCAGGG - Intergenic
1101314739 12:103618827-103618849 CAATTTAAGGTGAGACTGGGTGG - Intronic
1101593374 12:106141538-106141560 CCATTTAAGGAGACGGAGCATGG - Intergenic
1102695311 12:114794402-114794424 CAATGAAAGGAGAGCTTGCATGG + Intergenic
1104170677 12:126277350-126277372 CAAGTTAGGAAGAGGCTGAATGG + Intergenic
1105424655 13:20284120-20284142 CCATCTCAGGAGAGGCTGCAAGG + Intergenic
1105913307 13:24891194-24891216 CAAGTGAAGAAAAGGCTGCAAGG - Intronic
1107883505 13:44854647-44854669 CTCATTAAGGAGGGGCTGCAGGG - Intergenic
1108785154 13:53891477-53891499 CAATTTAAGAAGTGGCTGGGAGG + Intergenic
1109721670 13:66283338-66283360 AAATATAGGCAGAGGCTGCATGG + Intergenic
1111275191 13:85938091-85938113 CCATCTTAGGAGAGGCTGCAAGG + Intergenic
1112951444 13:105001975-105001997 CAATTTAAGGAAAGAATTCAGGG + Intergenic
1114811124 14:25900854-25900876 CAATTGAAGTGGAGGCTGGAGGG - Intergenic
1116639703 14:47445487-47445509 CAATTTAAATAGAGTATGCAAGG - Intronic
1117462851 14:55963547-55963569 CACTTTAAGCAGATGCTGCATGG - Intergenic
1117709124 14:58505601-58505623 CAATTTCAGGAGGGGATGTAAGG - Intronic
1119599076 14:75962584-75962606 GAATTTGAGCAGAGGCTTCAAGG - Intronic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1120250508 14:82057357-82057379 TAATTTAAGGAGATGCCGTATGG - Intergenic
1120443568 14:84566293-84566315 CCGTCTCAGGAGAGGCTGCAAGG - Intergenic
1120719743 14:87878133-87878155 CAAGTTACGGGGAGGATGCAAGG - Intronic
1120745066 14:88145183-88145205 CCATCTCAGGAAAGGCTGCAAGG + Intergenic
1122642127 14:103166115-103166137 CCATCTCAGGAGAGGCTGCAAGG + Intergenic
1122815870 14:104313722-104313744 GAAATTAAGGAGTGGGTGCAGGG + Intergenic
1124654660 15:31498650-31498672 CATTTTAAGATGTGGCTGCAAGG + Intronic
1124665318 15:31587156-31587178 TATTTTAAGGTGAAGCTGCAAGG - Intronic
1125118411 15:36122851-36122873 GCATTTAAGCAGAGGCTGAAGGG + Intergenic
1126136375 15:45396409-45396431 CAATTTAGGGAGAGATTGGAGGG + Intronic
1126444161 15:48723368-48723390 CATATAAGGGAGAGGCTGCAGGG - Intronic
1132794071 16:1710002-1710024 CTATGTAAGGAAAGGATGCAAGG + Intronic
1133971278 16:10569979-10570001 GCATTGAAGGGGAGGCTGCAAGG - Intronic
1137496609 16:48974139-48974161 AAATTTCAGGAGAGGATTCAGGG - Intergenic
1138812604 16:60168381-60168403 CAGTTTAGGCAGATGCTGCAAGG - Intergenic
1138919148 16:61505400-61505422 CAATTCAAAAAGAGACTGCAAGG - Intergenic
1142566573 17:844105-844127 CCAGTTAAGGAGAGGCAGGACGG - Intronic
1142566597 17:844204-844226 CCAGTTAAGGAGAGGCAGGATGG - Intronic
1144714826 17:17426688-17426710 CCATCTCAGGAGAGGCTGCAAGG + Intergenic
1146824389 17:36010332-36010354 CCATCTCGGGAGAGGCTGCAAGG + Intergenic
1146968425 17:37052725-37052747 CACTTTAAGGAGGGGCTCGAGGG - Intronic
1147864291 17:43542802-43542824 CAATTTGAAGAGAAGCAGCAGGG - Intronic
1148348296 17:46919257-46919279 AAAATGAAGGAGAGGCTGGAGGG + Intergenic
1148939420 17:51195265-51195287 AAATAGAAGGAGAGGTTGCATGG + Exonic
1149164978 17:53740568-53740590 CAATCAAAGGAGAGAATGCATGG - Intergenic
1150499963 17:65641382-65641404 CTGATCAAGGAGAGGCTGCAGGG - Intronic
1150587614 17:66532806-66532828 CATGTTCAGGAGAGGCAGCAAGG - Intronic
1151677511 17:75606189-75606211 GTATTCAAGCAGAGGCTGCACGG - Intergenic
1151924585 17:77185463-77185485 AAATTCAAGGTGAGGCTGCGTGG + Intronic
1153428372 18:4990004-4990026 CCATCTCAGGAGAGGTTGCAAGG - Intergenic
1155786937 18:29913703-29913725 CCATCTCAGGAGAGGCTGCAAGG + Intergenic
1158187132 18:54783629-54783651 CAATTTATTGTGAGGATGCACGG + Intronic
1159055704 18:63461588-63461610 CCAATTAAGGAAAGGCTTCAAGG - Intergenic
1164143437 19:22494478-22494500 CCATCTCAGGAGAGGCTGCCAGG + Intronic
1165196702 19:34109712-34109734 CAAGTGAAGGAGAGGCTGTTGGG - Intergenic
1167054655 19:47102081-47102103 CAATGTGAGGAGAGGCTGCAAGG + Intronic
925201175 2:1968764-1968786 CTCTTTAGGCAGAGGCTGCACGG + Intronic
925705957 2:6684885-6684907 AAATCTCAGGAGAAGCTGCAAGG - Intergenic
926446792 2:12952663-12952685 GAATCTGAGGAGAGGCTGAAAGG + Intergenic
928752465 2:34486706-34486728 CAATAAAAAGAGAGGCAGCAAGG - Intergenic
930233373 2:48865307-48865329 CAGTCAAAGGAGAGGCTGGAGGG + Intergenic
931206264 2:60148915-60148937 AAATCTAAGCAGAGGCAGCATGG + Intergenic
931676898 2:64706227-64706249 GAATATAAGAAGAGTCTGCAAGG - Intronic
932012881 2:67995451-67995473 TAGTTTAAGAAGAGGCTGCTGGG - Intergenic
934150952 2:89147098-89147120 CAATTTACAGACAGGCAGCAAGG + Intergenic
934216321 2:90034927-90034949 CAATTTACAGACAGGCAGCAAGG - Intergenic
935580154 2:104749821-104749843 CAATTTAAGGGGAGGCTGGCTGG - Intergenic
935890598 2:107673796-107673818 CAATTTGAAGAGACGCAGCAAGG - Intergenic
936625347 2:114142463-114142485 CAATCTCAGGAGAGTCTGAATGG - Intergenic
937312197 2:120909272-120909294 ACATTTGAGAAGAGGCTGCAGGG - Intronic
939131379 2:138239749-138239771 AAATTTAATGAGTGGCTGGAAGG + Intergenic
939437497 2:142197537-142197559 CAATTGATTGAGAGGGTGCATGG + Intergenic
940711503 2:157167703-157167725 CAAGTGAAGCAGAGGCAGCAAGG + Intergenic
942377233 2:175350107-175350129 CAATTCAAGGAGAGGCACAAAGG - Intergenic
942648308 2:178139214-178139236 CAATTTAAGGAGAAGTTATAAGG + Intergenic
943179981 2:184529258-184529280 CCATAAAAGGAGATGCTGCAAGG - Intergenic
943383409 2:187176261-187176283 CCATCTCAGGAGAGGCTGCAAGG - Intergenic
944088239 2:195874312-195874334 CAGTTTAAGGAGATGGTGAAAGG + Intronic
944222093 2:197312481-197312503 CTATTTAAGTAGAGAATGCAGGG - Intergenic
944609008 2:201380978-201381000 GGATTTAGGGAGAGGCTGGAGGG + Exonic
946848355 2:223881159-223881181 CAATTTAAGAATAGACTGCTAGG + Intronic
948556584 2:238815427-238815449 CAACTCAAGCAGAGGCTGCATGG + Intergenic
949038981 2:241836686-241836708 CAATTTAAAAAGAGCCTACACGG - Intergenic
1169148619 20:3271382-3271404 CCATGTAAGAAGAGGTTGCAGGG + Intronic
1173189567 20:40865597-40865619 CAAGAAAAGAAGAGGCTGCAAGG - Intergenic
1173851144 20:46219032-46219054 GAATGGAAGGAGAGGCTGTAGGG + Intronic
1174033174 20:47647337-47647359 CAGCTTCAGCAGAGGCTGCAGGG + Exonic
1174676775 20:52365390-52365412 CAATTTAAGGAGAGCATTCAGGG - Intergenic
1176307762 21:5133102-5133124 CAAATTCAGGAAAGGCTGCCTGG + Intronic
1178713972 21:34946632-34946654 CAATTTAGGAAGTGGCTGCTGGG + Intronic
1179849299 21:44128928-44128950 CAAATTCAGGAAAGGCTGCCTGG - Intronic
1183339352 22:37271042-37271064 CAGAGAAAGGAGAGGCTGCAGGG + Intergenic
952511147 3:34057404-34057426 CAAACCAAGGAGAGGATGCACGG - Intergenic
953227234 3:41031835-41031857 CAATATAAGTACATGCTGCAAGG - Intergenic
953360406 3:42290744-42290766 AAAATTAGGGAGAGGCTCCAGGG - Intergenic
955578157 3:60388786-60388808 CAATTCCATGAGATGCTGCATGG - Intronic
956557817 3:70541554-70541576 CCATCTCAGGAGAGGCTACAAGG - Intergenic
957634872 3:82769375-82769397 CAATTTATGGAAAGGCTGTAGGG + Intergenic
958467012 3:94471493-94471515 CCATCTCAGGAGAGGCTACAAGG - Intergenic
958869264 3:99537896-99537918 CAAGTCATGGAGAGGCTTCAGGG + Intergenic
959254317 3:103990797-103990819 CCATCTCAGGAAAGGCTGCAAGG - Intergenic
960083854 3:113569772-113569794 CAATTAAATCAGAGGCTGTAGGG + Intronic
960350324 3:116585236-116585258 TAATGGAAGGAGAGGGTGCAAGG + Intronic
963761399 3:149289870-149289892 CCATCTCAGGAAAGGCTGCAAGG + Intergenic
964245060 3:154642213-154642235 CAAGGAAAGGAGAAGCTGCAGGG - Intergenic
964710764 3:159669038-159669060 TCATTTAAGGAAGGGCTGCATGG + Intronic
964969301 3:162540217-162540239 AAATTAAAAGAGAGGCTTCATGG - Intergenic
965300499 3:167000486-167000508 CCATTTCAGGAGAGGTTGCAAGG - Intergenic
967109360 3:186279951-186279973 ATATTGAAGGAGATGCTGCAAGG - Exonic
967929171 3:194678183-194678205 CCATGAAAGGAGAGGCTCCAAGG + Intergenic
969277319 4:6145249-6145271 ATATTGAAGGAGATGCTGCATGG - Intronic
969452374 4:7281969-7281991 CAATTTCAGGAGTGGGTGCGTGG - Intronic
971015383 4:22483857-22483879 GAAGTTGAGGAGAGGCTGGAGGG + Intronic
976922258 4:90455056-90455078 CAATTTCAGAAAAGGCTGCAAGG - Intronic
980786429 4:137562048-137562070 CAAATCAAGCAGAGGCTGAAGGG - Intergenic
985430932 4:189879355-189879377 GATTTTAAGGAGAGGCCCCAAGG - Intergenic
986466257 5:8027735-8027757 GACTTCAAGGAGAGACTGCAAGG - Intergenic
987912615 5:24168617-24168639 CAATTTAAGTCAAGGCTGAAAGG - Intronic
988817544 5:34849719-34849741 CAATTTAAGGTGAGGATGGGTGG + Intronic
989118873 5:37983501-37983523 CACTTTAAGGAGAGGCAGCATGG - Intergenic
989820961 5:45795661-45795683 CCATCTCAGGAGAGGCTTCAGGG + Intergenic
990005309 5:50938509-50938531 GAACTTAAGGAGGGGTTGCAGGG + Intergenic
992641507 5:78772359-78772381 CAATTTAAGGAAAGGCACCATGG + Intergenic
994430603 5:99654958-99654980 GAATATAAGGAAAGGCTACATGG - Intergenic
994774504 5:104025960-104025982 CCATTTCAGGAGAGGCTGCAAGG + Intergenic
994824043 5:104690234-104690256 CATTTTAAGGAGAGGTGCCAAGG + Intergenic
994899569 5:105753700-105753722 TAATTTAAGGAGGGAATGCATGG - Intergenic
995254943 5:110035376-110035398 ATATTTAATGAGAGGCTGCTTGG + Intergenic
996374298 5:122787653-122787675 CAACTCAAGTAGAGGCTGCTGGG - Intronic
997699760 5:135888787-135888809 GGATTTAGGGAGAGGCTTCAGGG + Intergenic
998714927 5:144872294-144872316 GCATTTAGGGAGAGGCTGAAGGG + Intergenic
1000462597 5:161541520-161541542 CAATTTATGCAGAAGATGCAAGG - Intronic
1001154624 5:169262413-169262435 CAGTTGAAGGACAGGCTGAAGGG + Intronic
1002567416 5:180119695-180119717 CACCTTCAGGAGAGGCTCCATGG + Intronic
1007177530 6:39906983-39907005 CACTTTATGGAAAGGATGCAGGG - Exonic
1009050188 6:58265514-58265536 CAAGTTAAAAAGAGGCTACATGG - Intergenic
1009242911 6:61201794-61201816 CCATCTCAGGAGATGCTGCAAGG - Intergenic
1009573300 6:65418125-65418147 CAATTTTAGGTTAGGCTACATGG + Intronic
1010398370 6:75418999-75419021 CCAATTAATGGGAGGCTGCAGGG - Intronic
1011781810 6:90797895-90797917 AAATTTAAGGAGAGGATCCTAGG - Intergenic
1012113133 6:95261361-95261383 CCATCTCAGGAGAGGCTGCAAGG - Intergenic
1013996878 6:116319463-116319485 GAATGTAAGCAGAGGCTTCAAGG - Intronic
1014277113 6:119399637-119399659 CTATCTCAGAAGAGGCTGCAAGG - Intergenic
1014458245 6:121664031-121664053 CAATTTAAGGGGAGGATCAAGGG + Intergenic
1014761734 6:125363962-125363984 CTCTTTCAGGAGAGGCTGGAGGG + Intergenic
1014899218 6:126942942-126942964 TAATTTTTGAAGAGGCTGCATGG + Intergenic
1016336162 6:143007341-143007363 CAATTTGAGGAGAGTCTAAAGGG + Intergenic
1018667512 6:166152643-166152665 CAATTTAATCAGATACTGCAAGG - Intergenic
1019042681 6:169119694-169119716 CCATCTCAGGAGAGGCTGCAAGG + Intergenic
1019177156 6:170165793-170165815 TAATTTACAGAGAGGCTGCGTGG + Intergenic
1020128746 7:5547752-5547774 CAATTTAGGGAGAGCCTGACAGG - Intronic
1020790999 7:12628091-12628113 CAAACGAAGGAGAGGCTGCCAGG - Intronic
1020930228 7:14383773-14383795 AAATTTCAGAAGAGGCTGGAAGG + Intronic
1021914477 7:25417850-25417872 CAACTCATGGAGAGGCTGCAGGG + Intergenic
1029002715 7:97172133-97172155 AAATTTAAACAGAGGCTGAAAGG - Intronic
1029368813 7:100134449-100134471 CAATTAAAGGTGGGGCTGCAGGG - Intergenic
1031154666 7:118095630-118095652 CCATTCAAGGTGAGGCTGCTGGG + Intergenic
1031662007 7:124437073-124437095 CAACTTAAAGAGAGCCTGTATGG + Intergenic
1032905597 7:136360731-136360753 AAAGGTAAGGAGAGACTGCAAGG + Intergenic
1032917873 7:136511776-136511798 CCATCTCAGGAGACGCTGCAAGG - Intergenic
1033319755 7:140328680-140328702 CAATTTAAGGAGAGGCTGCATGG + Intronic
1033712177 7:143959145-143959167 GAATTTGTGGAGAGGATGCAGGG + Intergenic
1034491509 7:151395564-151395586 CAGGTTAAGGAGAGGCCTCACGG + Intronic
1036685252 8:10905135-10905157 CAGCTTCAGGAGAGGATGCAGGG - Intronic
1039210742 8:35211198-35211220 CAATTTAAGGCATGGCTACAAGG - Intergenic
1040614414 8:49020078-49020100 CAATTTGTGTAGAGGCAGCAGGG - Intergenic
1042736770 8:71998435-71998457 CAATTATAGGAGGAGCTGCAGGG + Intronic
1043438239 8:80254645-80254667 CATTTTACAGAGAGGCAGCAAGG + Intergenic
1044008520 8:86964804-86964826 CCATCTCAGGAGAGGCTGCAAGG - Intronic
1044659747 8:94583286-94583308 CAAATTCAGGAAAGGCTTCAGGG - Intergenic
1045808782 8:106197297-106197319 CATTTTAAGGAGAGTGGGCAAGG - Intergenic
1050841995 9:10161602-10161624 AAATTTAAGGATATGCTTCAGGG + Intronic
1051029405 9:12657071-12657093 CCATATTAGGAGAGGCTGCAAGG - Intergenic
1051566293 9:18502746-18502768 CAATATGACAAGAGGCTGCAAGG + Intronic
1051859641 9:21609778-21609800 GAATTTAGGGTGAGTCTGCAGGG - Intergenic
1052995093 9:34547713-34547735 CAGTTTGGGGAGAGGCTGGAAGG - Intergenic
1055375716 9:75646972-75646994 CCATCTCAGGGGAGGCTGCAAGG - Intergenic
1055982999 9:82024493-82024515 CAATTTAAGGTGAGTCTCAAAGG + Intergenic
1059275649 9:113094702-113094724 CTCTTCAAGGAGAGGCTCCAAGG + Intergenic
1059578210 9:115514667-115514689 AACTTGAAGGAGGGGCTGCAAGG + Intergenic
1059791729 9:117647889-117647911 GAATTTAAGGAGAGGCTTATGGG + Intergenic
1059906641 9:118993862-118993884 GAATTTAGTGAGAGGCTGGATGG + Intergenic
1187047941 X:15666388-15666410 GAATTTATGAAGAGGCAGCATGG - Intergenic
1187053671 X:15719137-15719159 GAATTTATGAAGAGGCAGCATGG - Intronic
1187652389 X:21422862-21422884 CAATTTAAGAAAAGACTGGATGG + Intronic
1187799284 X:23042453-23042475 CAATCAATGGAGAGGCTGAAAGG + Intergenic
1188102587 X:26108351-26108373 AAATTTAAGGGAAGTCTGCATGG - Intergenic
1190828931 X:54043649-54043671 CAGTTTGAGGGGGGGCTGCAAGG - Intronic
1193147908 X:78096479-78096501 CAATTTCTGGAGAGACGGCAAGG + Intronic
1193468486 X:81873489-81873511 CCATCTCAGGAGAGGCTGCAAGG - Intergenic
1193574768 X:83184131-83184153 CCATCTCAGGAGAGACTGCAAGG - Intergenic
1195853742 X:109309085-109309107 CCATCTCAGGAGATGCTGCAAGG - Intergenic
1198609508 X:138382492-138382514 CAATTTATGTTGAGGCTACATGG - Intergenic
1198752180 X:139946847-139946869 CAAATCCAGGAGATGCTGCAAGG - Intergenic
1202073240 Y:21014329-21014351 CCACATCAGGAGAGGCTGCAAGG - Intergenic
1202077940 Y:21056183-21056205 CCACATCAGGAGAGGCTGCAAGG - Intergenic