ID: 1033322118

View in Genome Browser
Species Human (GRCh38)
Location 7:140349415-140349437
Sequence CCCCTCAAGGGAGAGCCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033322118_1033322123 9 Left 1033322118 7:140349415-140349437 CCTCGTGGCTCTCCCTTGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1033322123 7:140349447-140349469 CTGCAGCTGCATGAAGATGGTGG 0: 1
1: 0
2: 4
3: 45
4: 304
1033322118_1033322122 6 Left 1033322118 7:140349415-140349437 CCTCGTGGCTCTCCCTTGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1033322122 7:140349444-140349466 ATGCTGCAGCTGCATGAAGATGG No data
1033322118_1033322125 13 Left 1033322118 7:140349415-140349437 CCTCGTGGCTCTCCCTTGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1033322125 7:140349451-140349473 AGCTGCATGAAGATGGTGGTGGG 0: 1
1: 0
2: 0
3: 30
4: 269
1033322118_1033322124 12 Left 1033322118 7:140349415-140349437 CCTCGTGGCTCTCCCTTGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1033322124 7:140349450-140349472 CAGCTGCATGAAGATGGTGGTGG No data
1033322118_1033322126 14 Left 1033322118 7:140349415-140349437 CCTCGTGGCTCTCCCTTGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1033322126 7:140349452-140349474 GCTGCATGAAGATGGTGGTGGGG 0: 1
1: 1
2: 2
3: 46
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033322118 Original CRISPR CCCCTCAAGGGAGAGCCACG AGG (reversed) Intronic
900301988 1:1982412-1982434 CCCCGCCAGGGACAGACACGGGG + Intronic
900699434 1:4034915-4034937 CACCTCAAGGGAGCACCCCGTGG + Intergenic
901394947 1:8974339-8974361 CCCCTCAGGCAAGGGCCACGGGG + Exonic
901602065 1:10430353-10430375 CCCCTCAACGGAGCGCCGCCAGG + Exonic
901687928 1:10954526-10954548 CCCATCAGGGGACAGCCACAGGG - Intronic
903849420 1:26297142-26297164 CCCATCAAGGCACCGCCACGGGG - Intronic
905919037 1:41707136-41707158 CCCTTCAAGGGGCAGCCCCGGGG - Intronic
906314167 1:44775699-44775721 CCCGGCCAGGGACAGCCACGAGG + Intronic
917962312 1:180154810-180154832 GCCCGCAAGGAGGAGCCACGTGG - Intergenic
919755747 1:201065068-201065090 CTCCCCAAGGAAAAGCCACGTGG + Intronic
922886605 1:229025253-229025275 CCCCTCCAGGAAGAGCCACCAGG + Intergenic
1066516858 10:36172075-36172097 CTGCTCCAGGGACAGCCACGGGG - Intergenic
1072664418 10:97383540-97383562 CCCAGCAAAAGAGAGCCACGAGG + Intronic
1074755456 10:116621153-116621175 CACCTCAAGGGAGAGCCCTGTGG + Intronic
1075818234 10:125282976-125282998 CCCCTAAAGGAAGAGAGACGGGG + Intergenic
1083624199 11:64063726-64063748 CCCCTCCATGGGCAGCCACGCGG + Intronic
1084426493 11:69087022-69087044 CCCCTCCAGGGTCAGCCACAGGG - Intronic
1084571494 11:69962587-69962609 CCCCTCAAGAGATGGCCACCAGG + Intergenic
1087172798 11:95067524-95067546 AGCCGCCAGGGAGAGCCACGCGG + Exonic
1091824009 12:3496136-3496158 CACCTCAAAGGAGAGCCCCCAGG + Intronic
1102877485 12:116459185-116459207 ACCCTAAAGTGAGAGCCACTGGG - Intergenic
1103365825 12:120382461-120382483 CTCCTCAAAGGAGAGCCAGTGGG + Intergenic
1112504488 13:99968152-99968174 CCCCAAAAGGGAGAGCGGCGTGG + Intronic
1113182338 13:107643842-107643864 AGCCTCAAGGGAGATCCAGGTGG + Intronic
1113378240 13:109783363-109783385 CCCCTCCAGGGACAGGCGCGTGG + Exonic
1113465545 13:110510246-110510268 CCCTACAAGCGAGCGCCACGTGG + Intronic
1114808985 14:25873699-25873721 CACGTCAAGGCAGAGCCACATGG + Intergenic
1118181333 14:63496200-63496222 GCCCTCAAGAGTGAGCCACTTGG + Intronic
1118704315 14:68466490-68466512 CCTCTCAGGGCAGAGCCACTTGG - Intronic
1121777326 14:96599189-96599211 CCTCTGAAGGCAGAGCCAAGAGG + Intergenic
1124376778 15:29133552-29133574 CCCCTCCATGGTGCGCCACGTGG + Intronic
1124414850 15:29466533-29466555 ACCCCCAAGGGAGAGCCCAGGGG + Intronic
1124597696 15:31104170-31104192 CTCCTCATGGGGGAGCCATGAGG + Intronic
1129038336 15:72664489-72664511 CTTCTCCCGGGAGAGCCACGAGG - Exonic
1129211554 15:74072742-74072764 CTTCTCCAGGGAGAGCCACGAGG + Exonic
1129329178 15:74818131-74818153 CCCCTTAAGGAAGGGCCACAGGG + Intronic
1129398850 15:75268342-75268364 CTTCTCCAGGGAGAGCCACGAGG - Exonic
1129402458 15:75292618-75292640 CTTCTCCAGGGAGAGCCACGAGG - Exonic
1129475996 15:75785046-75785068 CTTCTCCAGGGAGAGCCACGAGG - Intergenic
1129728672 15:77917017-77917039 CTTCTCCAGGGAGAGCCACGAGG + Intergenic
1137723133 16:50639476-50639498 CTCCTCAAGGCAGGGCCACTGGG - Exonic
1142303713 16:89274159-89274181 CTGCCCCAGGGAGAGCCACGGGG + Intronic
1142503632 17:348781-348803 ACTCCCAAGGGAGGGCCACGTGG - Intronic
1144674143 17:17151317-17151339 CCAGCCAAGGGAGAGCCATGTGG + Intronic
1144780518 17:17806054-17806076 CCACTCAAGGGTGAGCCCCTTGG - Intronic
1148052148 17:44774678-44774700 CCCCTGAGGGGTGAGCCAGGCGG - Exonic
1149507940 17:57211410-57211432 ACCCTCAAGGGTGAGCCATCAGG + Intergenic
1149637766 17:58184373-58184395 CCCCTCCTGGGTGAGCCACGTGG - Intergenic
1151495080 17:74454069-74454091 GCCCTCGCGGGAGAGGCACGTGG - Intergenic
1152030418 17:77838797-77838819 ACCCTAAAAGGAGAGCCATGCGG + Intergenic
1152234704 17:79132662-79132684 CCGCTCAAGGGCGAGTCAGGCGG - Intronic
1153331497 18:3879598-3879620 CCCCTCCAGGGAGTGCGACTTGG + Exonic
1153541401 18:6159657-6159679 GCCCTTCAGGGAGAGCCATGTGG - Intronic
1157908839 18:51596042-51596064 CCCCTCAAGGTACACCCACAGGG + Intergenic
1160047509 18:75400573-75400595 CTCCTCAATGCAGAGCCACCAGG + Intergenic
1161234954 19:3193164-3193186 CCCCTCCAGGGACAGTCACTGGG + Intronic
1161353139 19:3804644-3804666 CCCCTGTGGGGAGAGCCACAGGG - Exonic
1161364124 19:3868618-3868640 CCCCTGATGGGGGCGCCACGAGG - Intronic
1162063646 19:8111597-8111619 GCCCTAGAGGGACAGCCACGGGG - Intronic
1163150627 19:15411207-15411229 TCCCTGAAGGGTGAGCCACTTGG + Intronic
1163596686 19:18224897-18224919 CCCCTCGAGGGGGAGGCATGCGG + Intronic
1164859177 19:31549133-31549155 CCCCTCAAGGGCCAGCCAGCAGG - Intergenic
1168584807 19:57583719-57583741 CCCCGCAAGGGAGGGGCACGAGG + Intronic
927143347 2:20144551-20144573 CCCCTCAAGGGAATGGCACCAGG - Intergenic
933641690 2:84769148-84769170 CCCTGTAAGGGAGAGCCATGGGG + Intronic
938358178 2:130668316-130668338 CCCCTAAAGGTAGGGCCACTAGG - Intergenic
946400580 2:219466347-219466369 CCCCTTCAGGGAGAGACTCGGGG - Intronic
946412852 2:219523609-219523631 CCCCTCCTGGGTGAGCCAGGTGG + Intronic
947362517 2:229360735-229360757 CCTCTCAAGAGTGAGCCACATGG + Intronic
1170665225 20:18380975-18380997 CCCCTCCAGGAAGAGCGACCAGG + Intergenic
1171043549 20:21789071-21789093 TCCTTCCAGGGAGAGTCACGCGG + Intergenic
1171371678 20:24666248-24666270 CTCCTCAAGAAAGAGCCCCGCGG + Exonic
1172614642 20:36275217-36275239 CCCCTCAAGTGAGGGTCAGGAGG + Intergenic
1173930031 20:46810979-46811001 CCCCACAACTGAGAGCCTCGTGG + Intergenic
1174722433 20:52827422-52827444 TCCCTCTAGGGAGAGCCAGAAGG + Intergenic
1180972846 22:19824646-19824668 CCCCTCTTGGGAGAGCCCTGGGG - Intronic
1181726481 22:24814636-24814658 TCCCAAAAGGGTGAGCCACGCGG - Intronic
1183315516 22:37135016-37135038 GCCCTCCAGGGAGAGCCCCGGGG - Intronic
1184516779 22:44967052-44967074 CTTCTCCATGGAGAGCCACGTGG + Intronic
1185119247 22:48956009-48956031 CACCTCAAGGGAAGGCCACAAGG - Intergenic
950525172 3:13519026-13519048 CCCCTCCAGGGTCAGCCTCGGGG - Intergenic
955687918 3:61563483-61563505 CACCCCAAGGGACAGCTACGAGG - Intronic
967977634 3:195044386-195044408 GCCCTCCAGGGAGAGCAAGGTGG - Intergenic
970641878 4:18075951-18075973 CCCCTAATGGAAGAGCAACGAGG - Intergenic
997267404 5:132502887-132502909 CCACCCAAGGGAGGGCCAAGGGG - Intergenic
998864090 5:146477446-146477468 ACCCTCAGGGCAGAGCTACGAGG + Intronic
1004165224 6:13251073-13251095 CCACTCATGGGAGAGGCATGTGG - Intronic
1004572774 6:16863846-16863868 GCCCTCAACGGAGAGGCACAAGG + Intergenic
1005094427 6:22098539-22098561 CCCTTCAAGGGCCAGCCACATGG + Intergenic
1007478534 6:42135145-42135167 CCCCACTGGGGAGAGCCACCGGG + Intronic
1013162947 6:107563759-107563781 CCCCTCAAGCCAAAGCCATGTGG - Intronic
1013480681 6:110550394-110550416 CCCTTCCCGGGAGAGCCAGGTGG + Intergenic
1019047508 6:169160261-169160283 CCCGTCATGGGACAGCAACGTGG + Intergenic
1019660859 7:2223328-2223350 CCCAACCAGTGAGAGCCACGCGG - Intronic
1021859393 7:24891272-24891294 CCCCTCAGGGGAGATCCTGGAGG + Intronic
1022993098 7:35727546-35727568 CCTCTCAGGCGAGAGCCACCTGG + Intergenic
1023817458 7:43961743-43961765 GCCCTGCAGGGAGAGGCACGGGG + Intergenic
1029742083 7:102496617-102496639 GCCCTGCAGGGAGAGGCACGGGG + Exonic
1029760072 7:102595782-102595804 GCCCTGCAGGGAGAGGCACGGGG + Exonic
1032584395 7:133132790-133132812 CCACTGAAGGGAGAGTCCCGTGG + Intergenic
1033322118 7:140349415-140349437 CCCCTCAAGGGAGAGCCACGAGG - Intronic
1035716453 8:1758947-1758969 CCCCTCAAGAGACAGCCGTGTGG + Intronic
1036286529 8:7448228-7448250 CACCGCAGGGGAGAGCCAGGGGG - Intronic
1036334948 8:7863300-7863322 CACCGCAGGGGAGAGCCAGGGGG + Intronic
1040337203 8:46422085-46422107 GCCCTCACGGGAGAGCCCTGGGG - Intergenic
1049434836 8:142581690-142581712 GCCATCAAGGGAGAGTAACGCGG - Intergenic
1053452466 9:38204469-38204491 TCCCTCAAGGGAGAGAGACCTGG + Intergenic
1058083444 9:100723169-100723191 TCCCTCATGGGAGAACCATGAGG - Intergenic
1058907960 9:109497223-109497245 CTCCTGAAATGAGAGCCACGAGG + Intronic
1060787696 9:126463653-126463675 CCCCTCAGGGGACAGCCACCTGG - Intronic
1061180222 9:129021151-129021173 CCCCTCAAGGGTCACCAACGGGG - Exonic
1061821057 9:133227357-133227379 CCACTCAGGTGGGAGCCACGCGG + Intergenic
1062398290 9:136361439-136361461 CCCCTCCCGGGGGAGCCACCTGG - Intronic
1190014120 X:46811914-46811936 GGTCTCAAGAGAGAGCCACGGGG - Intergenic
1200021953 X:153219174-153219196 CTCCTGAAGGGAGAGCCAGTGGG + Intergenic