ID: 1033322120

View in Genome Browser
Species Human (GRCh38)
Location 7:140349427-140349449
Sequence CAGCATTTTTTTCCCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 293}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033322120_1033322124 0 Left 1033322120 7:140349427-140349449 CCCTTGAGGGGAAAAAAATGCTG 0: 1
1: 0
2: 2
3: 20
4: 293
Right 1033322124 7:140349450-140349472 CAGCTGCATGAAGATGGTGGTGG No data
1033322120_1033322123 -3 Left 1033322120 7:140349427-140349449 CCCTTGAGGGGAAAAAAATGCTG 0: 1
1: 0
2: 2
3: 20
4: 293
Right 1033322123 7:140349447-140349469 CTGCAGCTGCATGAAGATGGTGG 0: 1
1: 0
2: 4
3: 45
4: 304
1033322120_1033322122 -6 Left 1033322120 7:140349427-140349449 CCCTTGAGGGGAAAAAAATGCTG 0: 1
1: 0
2: 2
3: 20
4: 293
Right 1033322122 7:140349444-140349466 ATGCTGCAGCTGCATGAAGATGG No data
1033322120_1033322126 2 Left 1033322120 7:140349427-140349449 CCCTTGAGGGGAAAAAAATGCTG 0: 1
1: 0
2: 2
3: 20
4: 293
Right 1033322126 7:140349452-140349474 GCTGCATGAAGATGGTGGTGGGG 0: 1
1: 1
2: 2
3: 46
4: 331
1033322120_1033322125 1 Left 1033322120 7:140349427-140349449 CCCTTGAGGGGAAAAAAATGCTG 0: 1
1: 0
2: 2
3: 20
4: 293
Right 1033322125 7:140349451-140349473 AGCTGCATGAAGATGGTGGTGGG 0: 1
1: 0
2: 0
3: 30
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033322120 Original CRISPR CAGCATTTTTTTCCCCTCAA GGG (reversed) Intronic
903957454 1:27035170-27035192 CAGCATTTTATTCCAGCCAATGG - Intergenic
906265810 1:44428457-44428479 AAGCAATTTTTTCCCCTTAAAGG - Intronic
907553437 1:55324053-55324075 AAGCCTTTATTTCCCCTCAGAGG + Intergenic
909412235 1:75367857-75367879 AGGCATTTTTTTCCCATAAATGG + Intronic
910112531 1:83697907-83697929 CAGCATTGTTTTCCCCAGATTGG + Intergenic
910314732 1:85869626-85869648 CAGCATTTGTTTGTCCTTAAAGG - Intronic
910836298 1:91516193-91516215 CATAATTTTTTCCCCCACAAAGG - Intronic
911253560 1:95608059-95608081 CAGCCTTTGTTTCCCAACAAAGG + Intergenic
914446739 1:147757133-147757155 CAGAATTTTTTTTTCCACAAGGG + Exonic
914721997 1:150296985-150297007 CAGCATTTTTTTCCTCACTGTGG - Intronic
916127100 1:161581345-161581367 CAGAATTTGTTTGCCCTCTAGGG + Intronic
916137020 1:161663149-161663171 CAGAATTTGTTTGCCCTCTAGGG + Exonic
918738664 1:188098753-188098775 CTGCATTTTTGTACCCTCTATGG + Intergenic
920226438 1:204442581-204442603 AAGCAGTTCTTTGCCCTCAATGG - Exonic
923972116 1:239216218-239216240 CTGTATTTTTTTTCCCTAAATGG + Intergenic
1067569287 10:47359916-47359938 CTGCCTTTCTTTCCCCTCCAGGG + Intergenic
1067885789 10:50087253-50087275 AAGCCTTTTCTTCCCCACAAAGG + Exonic
1070412145 10:76151397-76151419 CAGTTTTTTTTTCCCCTCCAAGG + Intronic
1071172566 10:82884155-82884177 CATCTTTTTTTTCCCCCCAAGGG - Intronic
1071504664 10:86225328-86225350 CAGCACTTTTTTGCCTTAAATGG + Intronic
1071758635 10:88574980-88575002 CAGCATATTGTTCTCTTCAAAGG - Intronic
1073536426 10:104280770-104280792 TACAATTTTTTTCCCCTTAAGGG + Intronic
1073923507 10:108486297-108486319 CAACTTTTTTTTTCCCCCAAAGG + Intergenic
1077137052 11:1005530-1005552 CAGCATTTTTTTACACTCAAAGG - Intronic
1078267992 11:9769303-9769325 CTTCATTTTTTTCCCCCAAAGGG + Intergenic
1079441814 11:20522616-20522638 CAGCACATTTTTCCCCTCTTTGG + Intergenic
1080763805 11:35277503-35277525 GTGCATTTTTTTCCACTCAAAGG + Intronic
1081499579 11:43652977-43652999 CAGCATTTTTTTTTCTTCCAGGG + Intronic
1081532836 11:43975175-43975197 CTCCATTTTTTTTCCCTCACTGG - Intergenic
1082667566 11:55992473-55992495 CACCATCTTATTTCCCTCAATGG - Intergenic
1084361631 11:68672384-68672406 AAGCACTTTTTTCCCCTCTAGGG - Intergenic
1084842820 11:71870423-71870445 CAGCAGGTTTCTCACCTCAAGGG - Intronic
1085912927 11:80849979-80850001 GAGGATTTTTTTCCTCTAAATGG - Intergenic
1087466571 11:98515323-98515345 CTGCATTTTTTTCCCCCCTGTGG + Intergenic
1088961163 11:114666381-114666403 AAGATTTTTTTTCCCCTAAAGGG + Intergenic
1090469799 11:126969937-126969959 CTTCCTTTGTTTCCCCTCAATGG - Intronic
1093237902 12:16634676-16634698 AAGTATTTTTTTTCCCTTAAGGG + Intergenic
1093279285 12:17172153-17172175 CAGCACATATTTCCCCTGAAAGG - Intergenic
1095320609 12:40820947-40820969 CAGCCTTATTTTCCCTACAAAGG - Intronic
1095341127 12:41089495-41089517 CACCATTTGTTTGCCCTCCAAGG - Intergenic
1096319602 12:50599656-50599678 CTGCAATTGTTTCCCCTGAAGGG + Intronic
1096361888 12:50994988-50995010 CACCATTTGTTTCCCGTCTATGG - Intronic
1096985187 12:55751427-55751449 CCTCAGTTTCTTCCCCTCAATGG + Exonic
1098143925 12:67479374-67479396 CAGAATTTCTTCTCCCTCAAGGG - Intergenic
1098651949 12:72982461-72982483 CAGCATTTTTTTCTGCTCGAGGG - Intergenic
1099330850 12:81284758-81284780 AACCATTTTTTTTCCTTCAAAGG - Intronic
1102611874 12:114119497-114119519 CAGCATTTTTTTGGACTCCAGGG + Intergenic
1104267315 12:127245564-127245586 GTGCATTTTTTTCCCCTGAGAGG - Intergenic
1104950021 12:132435731-132435753 CAGCATTTTTCTCTCTTAAAGGG + Intergenic
1105036012 12:132921757-132921779 CGGCAATTATTTCCCTTCAAAGG + Exonic
1105391178 13:19979882-19979904 AATCATTTTTTCCCACTCAATGG + Intronic
1105590096 13:21784815-21784837 CACCATTTTTCTCCCCTTCAGGG - Intergenic
1106312063 13:28563202-28563224 CAGCATTCTTATACCCACAAAGG + Intergenic
1106347067 13:28889243-28889265 CAACTTTTTTTCCCCTTCAATGG - Intronic
1107375242 13:39797327-39797349 CATCATTTTTATCACCTTAATGG + Intergenic
1107827664 13:44343928-44343950 GATCATTTTTTTGCCCTCAGAGG + Intergenic
1109730915 13:66412583-66412605 AAACACTTTTTTCCCCTCAGTGG + Intronic
1110560067 13:76901736-76901758 CAATATTATTTTCTCCTCAAAGG + Intergenic
1111301016 13:86350430-86350452 TAGCTTTTTTTTCCTCTAAAAGG - Intergenic
1111648534 13:91062120-91062142 CTACATTTTTTTGCTCTCAAGGG - Intergenic
1111805349 13:93033514-93033536 CAGCAATTTTTTTCTCTAAAGGG + Intergenic
1112240882 13:97679970-97679992 CAGAATCTTCTTCCCCTGAATGG - Intergenic
1112665247 13:101563714-101563736 CAGCATTATTTTATCCTTAAGGG - Intronic
1112802691 13:103130168-103130190 CAGCAGTATTTTCACTTCAAGGG + Intergenic
1112889716 13:104213955-104213977 GAGCATATTTTTCCCCCAAATGG + Intergenic
1112940852 13:104860228-104860250 CAGGATTTTTTTTCCCTGAGAGG - Intergenic
1114568736 14:23650894-23650916 CAGCATCTTTTAGCCTTCAAGGG - Intergenic
1114648423 14:24268452-24268474 CATCACTCTTTTCCTCTCAAGGG - Intronic
1115559296 14:34568788-34568810 CACCATTTTTAGCCCCTCCAGGG + Intronic
1115831704 14:37349914-37349936 CACCATTCTTTTCTCCTCCAAGG - Intronic
1117583551 14:57177128-57177150 CAGTATTTTTTTTTCCTCTAAGG - Intergenic
1117869312 14:60183184-60183206 CATCATTTTTTTCCCCGAGATGG - Intergenic
1120275565 14:82369266-82369288 CAGTATTTTTTTTCCCCCATGGG - Intergenic
1120295317 14:82633083-82633105 CATCATTTTTTCCCTCTCAGTGG + Intergenic
1120657599 14:87212830-87212852 CAGAATTTCTTTCCCCTTTAAGG + Intergenic
1124092825 15:26622509-26622531 CAGCGATTTTTTCCCCTCCGTGG - Intronic
1125736168 15:41927549-41927571 TAGCATGTTTTTTTCCTCAAGGG - Intronic
1125793785 15:42389539-42389561 CAGCATTTCTTTGCACTGAAAGG - Intronic
1130453724 15:84082436-84082458 AAGCATTTGTTCCCCCTCAAAGG - Intergenic
1130758242 15:86789476-86789498 CAGCTGTTTGTCCCCCTCAATGG - Intronic
1131657123 15:94472900-94472922 CAGCAATTTTTTTCTCACAAAGG + Intronic
1131718049 15:95135074-95135096 CAGCATGTTTATCACTTCAAGGG + Intergenic
1133251147 16:4482248-4482270 CAGCATATTTTTCCCCTTCTGGG - Intronic
1133586766 16:7203209-7203231 CAGAATTTTCTTCCCTTCTAAGG - Intronic
1134112989 16:11527408-11527430 TAGGCTTTTTTTCCCCTCATTGG - Intergenic
1134403808 16:13937708-13937730 CAGCATTTTTAATCCCTGAAAGG - Intronic
1135413925 16:22254709-22254731 CAGCAGTTTTCTCCCTGCAATGG - Intronic
1138446955 16:57070585-57070607 TAGCATCCATTTCCCCTCAAGGG - Exonic
1141067449 16:80925612-80925634 CAGCATGCTTTTCCCATCTAAGG + Intergenic
1144546492 17:16201050-16201072 TAGCTTTTTTTTCCCCCCAAAGG - Intronic
1146161924 17:30564748-30564770 CAGCATTAGTTTTCCCTCCAGGG - Intergenic
1146528707 17:33589692-33589714 CAGTATTTCCTTCCTCTCAAAGG + Intronic
1146974012 17:37095822-37095844 CAGCTTTTTCTTCCCATCCATGG + Intronic
1147578325 17:41615162-41615184 CAGCATTAGTTTTCCCTCCAGGG - Intronic
1148155539 17:45423389-45423411 CAGATTTTTTTTCTCATCAATGG - Intronic
1149580286 17:57745204-57745226 TATCATTTTTTTCCCCTGTAGGG + Exonic
1152413410 17:80143105-80143127 CAGCATTCTTTCCCCCATAAGGG - Intronic
1154407193 18:14103717-14103739 TAGCATTTTTTTACCCTTAGTGG - Intronic
1155464262 18:26118407-26118429 TAGCTTTTTTTTTCCCTCATGGG + Intergenic
1156002583 18:32401733-32401755 CAACATTTTTTTCCCCCGAATGG - Intronic
1157809206 18:50681888-50681910 CAGCATTTTATTCCTTTCTAAGG - Intronic
1157903751 18:51546604-51546626 AAGCTTTTTTTTTCCTTCAAAGG - Intergenic
1158826912 18:61231855-61231877 CATCATTTTTTTTCCTTCATAGG - Intergenic
1158859950 18:61582205-61582227 CACAATTATTCTCCCCTCAACGG + Intergenic
1158864546 18:61625479-61625501 ATGCAATTTTTTCCCCACAAAGG - Intergenic
1159225354 18:65526859-65526881 CAACATTTCTTTCCCCTTTATGG + Intergenic
1163703936 19:18801396-18801418 CAGCAGTTTCTTCCCTTCCATGG + Intergenic
1167849849 19:52192981-52193003 CAGCAATTTTTTCCCTGCAAAGG - Intronic
925690075 2:6512648-6512670 CAACATTTTTTACCCCTCAAAGG - Intergenic
925773237 2:7305015-7305037 CTGCATTTTGTTCCCCTCTCAGG + Intergenic
926476280 2:13326853-13326875 AAACATTTTTTTCCCACCAATGG + Intergenic
927103935 2:19808251-19808273 CAGCATCCTTTTCCTCTCTAAGG + Intergenic
928343573 2:30468641-30468663 AAACATTTTTATCACCTCAAAGG + Intronic
928971399 2:37033591-37033613 CAGTATTTTTTTCATCTGAAAGG + Intronic
929645500 2:43623140-43623162 CTTCATGTTTTTCCCCTCATAGG - Intergenic
929661280 2:43787282-43787304 CAGCATTACTTTCCCATCTATGG - Intronic
930765973 2:55085469-55085491 CAGAATTTCTTTCTCCTCAGAGG + Intronic
930985606 2:57583846-57583868 CAGCACTTTATTCCTCTTAATGG + Intergenic
933372178 2:81428551-81428573 CTGCATTCTTTTCCTCTCATAGG + Intergenic
934883265 2:98001995-98002017 TGGCCTTTTTTTCCCCTGAATGG - Intergenic
935498506 2:103810012-103810034 CAGCATTTCTTTCCACAGAAAGG - Intergenic
935856550 2:107280921-107280943 CTCCATTCATTTCCCCTCAAAGG - Intergenic
939666843 2:144963271-144963293 CAGCATTTTTGGGCTCTCAAAGG - Intergenic
940052983 2:149483304-149483326 CAGCATCTTTTTTTCCTCCAGGG - Intergenic
940499332 2:154474881-154474903 GAGGAGTTTTTTCTCCTCAAAGG - Intergenic
941359149 2:164530644-164530666 CAGCCTTTCTCTCACCTCAAGGG - Intronic
942561441 2:177224136-177224158 TATCCTTTTTTCCCCCTCAAAGG - Intergenic
943803288 2:192089339-192089361 TAGTCTTTTTTTCCCCCCAAAGG + Intronic
944994680 2:205280155-205280177 AAGCAATTTTTTTCCCTGAAAGG - Intronic
945189432 2:207171228-207171250 CAGCATTTTTGTCACCTCTTTGG - Intergenic
945208450 2:207357243-207357265 CCCCATTATTTTCCCCTCCAGGG + Intergenic
946085288 2:217164387-217164409 TAGCATTATTTTCCCCACAGTGG - Intergenic
947450147 2:230200268-230200290 TAGCTGTTTTTTCCCCTCTAAGG + Intronic
948536063 2:238648288-238648310 TCACAATTTTTTCCCCTCAAAGG + Intergenic
1171515679 20:25731590-25731612 GACTACTTTTTTCCCCTCAATGG + Intergenic
1171989616 20:31685729-31685751 CCCTTTTTTTTTCCCCTCAAGGG + Intronic
1172414597 20:34754462-34754484 CAGTATTTTTTTTCTCTGAAGGG - Intronic
1173510790 20:43626669-43626691 TAGCATTTTTTTTCTTTCAATGG + Intronic
1174661573 20:52218080-52218102 CACTCTTTTTTTCCTCTCAAGGG + Intergenic
1174770964 20:53299946-53299968 CAGCACGTTTTTCCTCTCCAGGG + Intronic
1176239964 20:64071426-64071448 CAGCCTTTCCTTCCCCTCGAAGG + Intronic
1176893066 21:14342708-14342730 CAACATTTCTCTCCCCTGAATGG - Intergenic
1178253302 21:31025357-31025379 CATCATGTTTTTCCCCTCTGAGG + Intergenic
1180948799 22:19711265-19711287 TAGCATTTTTTTTTCCACAAAGG + Intergenic
1181872274 22:25909493-25909515 CAGTACTTTTTCCCCCTCCATGG + Intronic
950846981 3:16024004-16024026 AACCATTTTTTTCCCGCCAAAGG - Intergenic
952114829 3:30166298-30166320 AAACATTTTTATCACCTCAAAGG - Intergenic
952709206 3:36412515-36412537 CAGTCTTTTTTTCCCCCGAAAGG - Intronic
952736712 3:36698409-36698431 CAGCACTGTTTTCCTCTCATTGG + Intergenic
952799656 3:37277395-37277417 CACTATTTTTTTCCCCTCTTAGG + Intronic
953149320 3:40309902-40309924 CAGGAATTTTATCCCCTCACCGG + Exonic
956738037 3:72253782-72253804 CTGCATTATTTTCCACTGAATGG - Intergenic
956809942 3:72855260-72855282 GGGCAATTTTGTCCCCTCAAGGG - Intronic
957486057 3:80864739-80864761 CATCATTTATTGCTCCTCAATGG + Intergenic
958698994 3:97564634-97564656 CAACATTTTTTTTTCCTAAAAGG + Intronic
959056578 3:101573771-101573793 CTGCATTCTTTTTCCCTAAAGGG - Intergenic
959157539 3:102685045-102685067 AGACATTTCTTTCCCCTCAATGG + Intergenic
959268516 3:104173880-104173902 CATAATTATTTTCCCCTGAAAGG - Intergenic
959348950 3:105236053-105236075 CATCTTTTTTTCCCCCTCCAAGG - Intergenic
959619855 3:108388244-108388266 CTGTATTTTTCTCCCCTCCAGGG - Intronic
959647391 3:108718796-108718818 CAGAATTTTTGTACCCTCATTGG + Intergenic
959855186 3:111145987-111146009 CCTCATTTTTTTCACCTAAATGG + Intronic
960111984 3:113854082-113854104 CAGTCTTTTCTTCCCCTAAATGG - Intronic
961228772 3:125280836-125280858 CAGCATTGTTTCCCTCTCACTGG - Intronic
962490292 3:135887164-135887186 TAGCATGTATTTCCTCTCAAAGG + Intergenic
963209284 3:142671234-142671256 CAGTATTTTTTTCTCCTCAGTGG - Intronic
963702948 3:148649163-148649185 CAGCATTTTTTTTTCTGCAAAGG - Intergenic
963885818 3:150581140-150581162 CAAAACTTTTTTCCCCTTAAAGG - Intronic
963888620 3:150608370-150608392 CAGTATTTTTTTCTTCTAAATGG - Intronic
963964372 3:151349243-151349265 CACCATTTTTTTCCCCACGTGGG - Intronic
964026794 3:152083592-152083614 CTCCCTTTTTTTCCTCTCAAGGG - Intergenic
964192358 3:154018132-154018154 CAAAATTTTTTGCCTCTCAAGGG - Intergenic
964867602 3:161278226-161278248 CAGCATTTTTTTGCCTGAAAAGG - Intergenic
965072752 3:163936660-163936682 CAGCATTTTCTTCCTATAAATGG + Intergenic
966155722 3:176914306-176914328 CTGCATTCTTTTCCCCTAATCGG + Intergenic
966546384 3:181153961-181153983 GAGCATTGTTTTCCCCTGTAAGG + Intergenic
967672830 3:192259573-192259595 AAACATTTTTTTCCTCTCATGGG - Intronic
969783919 4:9436479-9436501 CAGCAGGTTTCTCACCTCAAGGG - Intergenic
971935894 4:33146691-33146713 CAGAATTTATTTTTCCTCAAGGG + Intergenic
971995005 4:33954637-33954659 CAGCATTTTCTTTGCCCCAAGGG + Intergenic
972487682 4:39557778-39557800 AAGCAGATTTTTCCCCCCAAAGG - Intronic
973129719 4:46635827-46635849 CAGCAGTTTTCTAACCTCAAGGG - Intergenic
975775315 4:77780027-77780049 CAGCTTTATTTTCCCCTCTCAGG + Intronic
976237991 4:82921166-82921188 AAACATTTTTTTCCATTCAATGG - Intronic
976608285 4:87002909-87002931 AAGAATTCTTTGCCCCTCAAAGG + Intronic
977451958 4:97210334-97210356 GAGATTTTTTTTCCCCTCAGGGG - Intronic
979066239 4:116137326-116137348 CAGCATATTTTTCACCTTTAAGG + Intergenic
981236599 4:142423410-142423432 TATCTTTTTTTTCCCCTAAATGG + Intronic
981296874 4:143142290-143142312 CAGCATTTTCTTCTCCGTAAAGG - Intergenic
983489772 4:168375004-168375026 TGGCATTTTTTTCCCCTGAGGGG - Intronic
983778707 4:171641861-171641883 AATCATTTATTGCCCCTCAATGG + Intergenic
984500633 4:180554613-180554635 CAGAATTTTTTTCCCAACATTGG - Intergenic
986592420 5:9385298-9385320 CAGCAATTTTTTTTCCTAAAAGG - Intronic
987476209 5:18394885-18394907 AAACATTTTTTTCCCCTCTTTGG + Intergenic
987662751 5:20898544-20898566 ATGCATTTTTTTCCCCAAAAAGG + Intergenic
988121611 5:26970961-26970983 TAACATTCTTTTCCCCTCTATGG - Intronic
989699697 5:44248260-44248282 CTGGATTGTTTTCCACTCAAAGG - Intergenic
990286733 5:54307932-54307954 GAGCATTTTTTTTCCCTGCAAGG + Intronic
991191816 5:63883293-63883315 CATCATCTTTTTCCCCTCCTTGG - Intergenic
991500403 5:67270554-67270576 CAGCATTTTCTTCCACCCAGAGG - Intergenic
993199490 5:84795907-84795929 CTTAATTTTTTTCCTCTCAATGG - Intergenic
993288168 5:86029283-86029305 CTGCATTTTTTCTCTCTCAATGG + Intergenic
994154087 5:96482837-96482859 CAGGATTTTTTCCCCGTCATGGG - Intergenic
995119749 5:108523127-108523149 ATACCTTTTTTTCCCCTCAATGG + Intergenic
995328173 5:110915836-110915858 CAGCATTTTTTCACCTTCCACGG - Intergenic
995890171 5:116942247-116942269 CAGCACTTTTCTTCCCTCATTGG - Intergenic
996779569 5:127171145-127171167 CAGAAGGTTTTTCCCCTCAGTGG + Intergenic
997073572 5:130645512-130645534 ATGCATTTTTTTTCCCTAAAGGG - Intergenic
997602690 5:135151125-135151147 CAGCCCTATGTTCCCCTCAAAGG - Intronic
998894447 5:146784143-146784165 CAGCCTATTTTTCCCCAAAATGG + Intronic
999163308 5:149524310-149524332 CAGCATTTTCCTGCCCTTAAAGG + Intronic
999904651 5:156126437-156126459 GAGCTTTATTTTCCCCTTAATGG - Intronic
999953004 5:156670454-156670476 CTTCCTTTTTTTCCCCTCAGTGG + Intronic
1000066346 5:157695861-157695883 GAGCTTTTTCTTCCCCTAAAGGG + Intergenic
1000228295 5:159291056-159291078 CTTCATTATTTTCCCCTCAGGGG - Intergenic
1001428834 5:171643792-171643814 CGGAATTTTTTTCCCTTCAAAGG + Intergenic
1003298747 6:4857425-4857447 CAGCATATTTTGCCCCACGAAGG - Intronic
1005645533 6:27834258-27834280 AAGCCTTTATTGCCCCTCAAAGG + Intergenic
1005992584 6:30912623-30912645 CCATGTTTTTTTCCCCTCAAGGG - Intronic
1007355757 6:41314880-41314902 CAGCCTTTTTTTGCCCTGTATGG - Intergenic
1008629652 6:53350987-53351009 CAACATGTTTTCCCCTTCAACGG - Intergenic
1008806612 6:55437410-55437432 CTGCATTTTTTTTTCCTCAGTGG - Intronic
1008892524 6:56511610-56511632 CAGCATCTTTGTACCCTAAAGGG - Intronic
1008948907 6:57132688-57132710 AAGGATTTTTTTTCCCTAAAGGG + Intronic
1012240183 6:96862329-96862351 CTGCTTTTTTTTCCCCTTTATGG - Intergenic
1012666935 6:101982968-101982990 AGGCATGTTTTTCCCCTCTAAGG - Intronic
1013159788 6:107531863-107531885 CAGCATTTTATTTACCTCAATGG - Intronic
1013729163 6:113142755-113142777 GAGGATTTTTTTTTCCTCAAAGG - Intergenic
1015433019 6:133153280-133153302 CAGCATTTTCTTCTCCGTAAAGG + Intergenic
1016015649 6:139182673-139182695 CAGCACTTTATTGTCCTCAAAGG - Intergenic
1017883314 6:158577110-158577132 CTTCATTTTTTTCCCTTCGATGG - Intronic
1018704391 6:166451909-166451931 CAGATTTTTTTTCCCCACGAGGG - Intronic
1018964313 6:168472712-168472734 CAGGCATTTTTTCCCCTCCAAGG + Intronic
1020585608 7:10062175-10062197 CAGCAGTGTTTTCCCCTCTAGGG + Intergenic
1021614582 7:22488698-22488720 CAGCAGTGGTTTCCTCTCAAGGG - Intronic
1023530035 7:41143539-41143561 AAACATTTTTTTCCCGGCAATGG - Intergenic
1023709693 7:42978573-42978595 CAGCATTTTTTTCCTATAAAAGG + Intergenic
1024089588 7:45924227-45924249 CAGGTTTTTTTTCCCCTTTAGGG + Intergenic
1027227883 7:76255985-76256007 CAGCATTTTACTTTCCTCAAAGG + Intronic
1027593525 7:80143532-80143554 AGGAATTTTTTTCCCCTCCAAGG + Intronic
1028175658 7:87655387-87655409 CAGGATTTTCTTCCTCTTAAAGG - Intronic
1028525746 7:91783930-91783952 CAGCCTTTTTTTCAGCTGAAAGG - Intronic
1028775178 7:94667817-94667839 CAACTTTTTTTTTCCTTCAATGG + Exonic
1028918290 7:96284187-96284209 CAGTATTTTTTTCTCCTAAGGGG + Intronic
1028962670 7:96767112-96767134 CAGGCTTCTTTTCTCCTCAATGG + Intergenic
1029054996 7:97732501-97732523 CAGAATTTTCTGCCCCACAACGG - Intronic
1030629335 7:111878712-111878734 CAGCTTTATTTTCTACTCAATGG - Intronic
1031462079 7:122063740-122063762 CAGAATTTTTTTACCCTTTAAGG + Intergenic
1031890982 7:127293263-127293285 CAGCTAATTCTTCCCCTCAACGG - Intergenic
1032356824 7:131218861-131218883 AAGCATTTTCTTCCCCTCTCCGG + Intronic
1032667067 7:134047298-134047320 CTCTATATTTTTCCCCTCAAAGG + Intronic
1033322120 7:140349427-140349449 CAGCATTTTTTTCCCCTCAAGGG - Intronic
1035493485 7:159300291-159300313 CAGCATTTGCTTCCCTGCAAAGG - Intergenic
1036010112 8:4712636-4712658 CAGCATCTTTTTCCTCTAATTGG + Intronic
1036595568 8:10208847-10208869 AAGCAGTTTTGTACCCTCAAAGG - Intronic
1036716864 8:11133633-11133655 CAGCATGCTTTTCCCAGCAAAGG - Intronic
1036835126 8:12057638-12057660 CAGCAGGTTTCTCACCTCAAGGG + Intergenic
1036856969 8:12304202-12304224 CAGCAGGTTTCTCACCTCAAGGG + Intergenic
1037075461 8:14711633-14711655 TAGCATTTTTTTCCGTACAAGGG - Intronic
1038005027 8:23422661-23422683 CAGCAATTTTTTTCTCTAAAGGG - Intronic
1038254026 8:25934133-25934155 GACCATTCTTTTTCCCTCAAAGG - Intronic
1038830392 8:31052113-31052135 CAGCAATTTTTTTCTCTAAAGGG - Intronic
1039141588 8:34395577-34395599 TTTCATTTTTTTCCCCTCAAGGG + Intergenic
1039203927 8:35128625-35128647 TAGCATTTGTTACCCCTCTAAGG - Intergenic
1039511936 8:38098954-38098976 CTGCATTTTTTTTCCATAAACGG - Intergenic
1040542726 8:48374319-48374341 CACAATTTTCTTCTCCTCAATGG + Intergenic
1040727852 8:50404978-50405000 CAGAATTTCATTCCCTTCAAAGG + Intronic
1041054322 8:53967285-53967307 CACTATTTTTTTCCCCTCTTAGG - Exonic
1041505965 8:58598123-58598145 CAGCATTGTTTTCTCCTGAGAGG + Intronic
1046468968 8:114643092-114643114 AAACTTTTTTTTCCCCTCAAAGG + Intergenic
1046752320 8:117939042-117939064 CTGTTTTTTTTTCCCCCCAATGG + Intronic
1047655222 8:126970034-126970056 GATCATTTTTCTCCCCTCAAAGG + Intergenic
1048400587 8:134065183-134065205 CAGCATTGGATCCCCCTCAAGGG + Intergenic
1049145580 8:140999441-140999463 CAGCCTGTTTTTCCCCACCAAGG + Intronic
1049372756 8:142275530-142275552 CAGCATTGTCTTCCACCCAAAGG + Intronic
1050427258 9:5523926-5523948 CAACATTTTTTATCCCTCATTGG + Intronic
1051007434 9:12363630-12363652 CAGCATTTTTTAACCCTAATGGG + Intergenic
1051540641 9:18212844-18212866 CACAAATTTTTTCCCCACAATGG + Intergenic
1051761752 9:20474676-20474698 CTGCTTTTTTTTCCCCTCGTTGG - Intronic
1052498416 9:29258155-29258177 TTGCATTTTTTTCCCTTCCAGGG + Intergenic
1053569046 9:39285126-39285148 CCTCAATTTTTTCCCCTAAATGG - Intronic
1053835009 9:42126173-42126195 CCTCAATTTTTTCCCCTAAATGG - Intronic
1054090679 9:60844103-60844125 CCTCAATTTTTTCCCCTAAATGG - Intergenic
1054112090 9:61119660-61119682 CCTCAATTTTTTCCCCTAAATGG - Intergenic
1054128097 9:61333881-61333903 CCTCAATTTTTTCCCCTAAATGG + Intergenic
1054595524 9:67061356-67061378 CCTCAATTTTTTCCCCTAAATGG + Intergenic
1055576049 9:77661156-77661178 AATCATTTATTGCCCCTCAATGG - Intergenic
1055601273 9:77921452-77921474 CAGCATTTATTTTCACTCAGGGG + Intronic
1055931045 9:81560145-81560167 CAGTTTTTTTCTCCCCTGAAGGG - Intergenic
1056619244 9:88196729-88196751 AATCATTTATTGCCCCTCAATGG - Intergenic
1057047113 9:91894377-91894399 CATTATGTTTTTCTCCTCAATGG - Intronic
1057518649 9:95742521-95742543 CAGCTTTTTTTTCCCCTTATTGG - Intergenic
1058268868 9:102943618-102943640 CAGAGTTTTTTTCACCTCAGGGG - Intergenic
1058384698 9:104420492-104420514 CAGCATTATTTTCACATAAAAGG - Intergenic
1059747730 9:117219362-117219384 CAGCATTTTTTTCCACTGCTTGG - Intronic
1061511661 9:131065091-131065113 CAGCATTCTTGTCACCTCCAGGG + Intronic
1203414109 Un_KI270589v1:33625-33647 AAGTATTTCTTTTCCCTCAACGG + Intergenic
1203684170 Un_KI270757v1:26253-26275 AAGTATTTCTTTTCCCTCAACGG - Intergenic
1185512089 X:671165-671187 AAGCATTTTCTTCCTCCCAATGG - Intergenic
1186572033 X:10725122-10725144 CAGCACTTTTTTCTCCTCCCAGG + Intronic
1186771384 X:12821272-12821294 CAGGATTTCTTTCCCTTTAAAGG - Intronic
1187137015 X:16557764-16557786 TTGCATTTTTTTCCCACCAAGGG - Intergenic
1187391626 X:18890096-18890118 CAGCTTTCTTTTCCCCTCACAGG + Intergenic
1187617734 X:21016140-21016162 CAGCATCTTTTCCCATTCAAAGG + Intergenic
1187970816 X:24656155-24656177 CATTATTTTTTTCCCCTAATGGG - Intronic
1189950014 X:46219622-46219644 CTACACTTTTTTCCCCTCTAGGG + Intergenic
1191191936 X:57677088-57677110 AAGCCTTTTTTCCCCCCCAAAGG + Intergenic
1191775287 X:64807448-64807470 CAGCTTTTCTTTCCTCTCCATGG - Intergenic
1194143439 X:90234192-90234214 CAATATTTTTTTTTCCTCAAGGG + Intergenic
1195206899 X:102610489-102610511 AAGGATTTTTTTCCTCCCAAGGG - Intergenic
1195234462 X:102883030-102883052 CAGCATGTTTCTCCTCCCAAAGG + Intergenic
1196317552 X:114246611-114246633 CAACATTTTTGTCACCCCAAAGG - Intergenic
1197571451 X:128155879-128155901 CATCATTTTTTTTCCCCCATTGG + Intergenic
1198643040 X:138777458-138777480 AAGCATTTTTGTCCCAACAAAGG + Intronic
1199400193 X:147389852-147389874 AAGCATGTTTCTGCCCTCAATGG - Intergenic
1200489193 Y:3803513-3803535 CAATATTTTTTTTTCCTCAAGGG + Intergenic