ID: 1033322121

View in Genome Browser
Species Human (GRCh38)
Location 7:140349428-140349450
Sequence GCAGCATTTTTTTCCCCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 289}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033322121_1033322123 -4 Left 1033322121 7:140349428-140349450 CCTTGAGGGGAAAAAAATGCTGC 0: 1
1: 1
2: 2
3: 30
4: 289
Right 1033322123 7:140349447-140349469 CTGCAGCTGCATGAAGATGGTGG 0: 1
1: 0
2: 4
3: 45
4: 304
1033322121_1033322122 -7 Left 1033322121 7:140349428-140349450 CCTTGAGGGGAAAAAAATGCTGC 0: 1
1: 1
2: 2
3: 30
4: 289
Right 1033322122 7:140349444-140349466 ATGCTGCAGCTGCATGAAGATGG No data
1033322121_1033322125 0 Left 1033322121 7:140349428-140349450 CCTTGAGGGGAAAAAAATGCTGC 0: 1
1: 1
2: 2
3: 30
4: 289
Right 1033322125 7:140349451-140349473 AGCTGCATGAAGATGGTGGTGGG 0: 1
1: 0
2: 0
3: 30
4: 269
1033322121_1033322126 1 Left 1033322121 7:140349428-140349450 CCTTGAGGGGAAAAAAATGCTGC 0: 1
1: 1
2: 2
3: 30
4: 289
Right 1033322126 7:140349452-140349474 GCTGCATGAAGATGGTGGTGGGG 0: 1
1: 1
2: 2
3: 46
4: 331
1033322121_1033322124 -1 Left 1033322121 7:140349428-140349450 CCTTGAGGGGAAAAAAATGCTGC 0: 1
1: 1
2: 2
3: 30
4: 289
Right 1033322124 7:140349450-140349472 CAGCTGCATGAAGATGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033322121 Original CRISPR GCAGCATTTTTTTCCCCTCA AGG (reversed) Intronic
900922289 1:5680848-5680870 GCATAACTTTTTTCCCCTCCAGG - Intergenic
901573642 1:10182459-10182481 GCAGCATTTTATTACATTCACGG - Intergenic
902728875 1:18355584-18355606 GCAGCAATTCTCTCCCCTTAAGG + Intronic
903504869 1:23826304-23826326 TCAGCATTTTCTTTGCCTCAGGG - Intronic
905807436 1:40887070-40887092 GGAACACATTTTTCCCCTCAAGG + Intergenic
905835769 1:41119415-41119437 CCAGCTTTTTTTTCCCTTTAGGG + Intronic
906402036 1:45511703-45511725 TTAGCTTTTTTTTCCCCTTAAGG - Exonic
906455826 1:45996082-45996104 GCTGCTTTTTTTTCCCCTCTCGG + Intronic
906716372 1:47972720-47972742 GCACCAATTTTTGACCCTCATGG + Intronic
907268829 1:53278563-53278585 GTTGAATTTTTTTCCCCTCCTGG + Intronic
908133613 1:61103375-61103397 GAAGCTTTCTTTTCCCCCCAAGG + Intronic
909251364 1:73360872-73360894 TCAGCCTTTTTTTTCCCCCATGG - Intergenic
909474693 1:76069740-76069762 GAACCATTTTTTTCCTCTAATGG - Intergenic
909476929 1:76091475-76091497 GCTCCATATTTTTGCCCTCAAGG + Intronic
909818761 1:80031336-80031358 GCAGCATTTATTTCCCCTTCTGG - Intergenic
909948936 1:81696192-81696214 GCAGAATTTTTTTTCCCTCTCGG + Intronic
911119682 1:94283065-94283087 GCAACATTTTTTTAACCTTAAGG + Intergenic
911229518 1:95346208-95346230 GCTTCATTTTTTTCCCCTACAGG + Intergenic
912654398 1:111472628-111472650 GCACTCTTTTTTTTCCCTCAAGG + Intergenic
912723861 1:112042165-112042187 GCACTATCTTTTTCCCCTGAAGG + Intergenic
913253712 1:116935139-116935161 ACTACATTGTTTTCCCCTCAAGG - Intronic
913665454 1:121044070-121044092 GAAACAATTTTTCCCCCTCAGGG - Intergenic
914016851 1:143827341-143827363 GAAACAATTTTTCCCCCTCAGGG - Intergenic
914160935 1:145133670-145133692 GAAACAATTTTTCCCCCTCAGGG + Intergenic
914446738 1:147757132-147757154 GCAGAATTTTTTTTTCCACAAGG + Exonic
914655461 1:149735882-149735904 GAAACAATTTTTCCCCCTCAGGG - Intergenic
915087360 1:153397704-153397726 GCAGCCTCTCTCTCCCCTCAGGG + Intergenic
916122029 1:161537194-161537216 GCTGAATTCTTTTCCCCACAAGG + Intergenic
916131918 1:161618619-161618641 GCTGAATTCTTTTCCCCACAAGG + Intronic
916378407 1:164181839-164181861 GCAGAACATTTCTCCCCTCAGGG + Intergenic
917490834 1:175497144-175497166 GTACCATTTTTTTCCCCTGAAGG - Intronic
918087764 1:181259947-181259969 GCACAATTTCTTTCTCCTCAGGG + Intergenic
919494413 1:198246376-198246398 GCGGCACCTTTTTCCCCCCATGG - Intronic
920493493 1:206437613-206437635 GCCTCATTTTTCTCCCCGCAGGG + Intronic
921273867 1:213497998-213498020 GCATTATTTTTTTCCCTTAACGG - Intergenic
921660595 1:217796558-217796580 GCAGCAATATCTTCCCCCCAGGG - Intronic
921760352 1:218906651-218906673 GCAGCTTTTGTTACCTCTCAGGG - Intergenic
921948670 1:220906834-220906856 CCATCATTTGTTTCCCCACAGGG - Intergenic
922128900 1:222757294-222757316 GCAGAATTTCTTTCTCTTCAGGG - Intergenic
923387939 1:233484125-233484147 CCAGCCTTTTTTGCCCCACATGG + Intergenic
924001262 1:239555192-239555214 GCAACAATTTTTTCCCCTTTAGG - Intronic
924259644 1:242216106-242216128 GCAACATTCTTTTCCAATCAAGG - Intronic
924673391 1:246151265-246151287 GGGGCTATTTTTTCCCCTCAAGG - Intronic
1063358313 10:5423744-5423766 AAATCATTTTTTTCCCCACAAGG + Intronic
1064205558 10:13320956-13320978 GCAGGGTTTTTTTCCCCTGCTGG - Intronic
1064453029 10:15460815-15460837 GCGGTTTTTTTTTCCCCTCTGGG - Intergenic
1070798921 10:79233653-79233675 GCCTGATTTTTTTCCCCTCCTGG + Intronic
1071172567 10:82884156-82884178 ACATCTTTTTTTTCCCCCCAAGG - Intronic
1071957892 10:90779046-90779068 GCAGCAGTTCTCTCCCTTCATGG - Intronic
1074382253 10:112990870-112990892 GTAGCATTTTTCTCCCCAGAGGG - Intronic
1074580782 10:114717567-114717589 GAGGCAGTTTTGTCCCCTCAGGG - Intergenic
1075045973 10:119147003-119147025 GCAGGAATGTCTTCCCCTCAGGG - Intronic
1075325414 10:121527974-121527996 GAAACATTTTCTTCCCCTGAAGG - Intronic
1075879063 10:125834423-125834445 CCAGCATTTTTTTCCTATAAAGG + Intronic
1076001118 10:126913764-126913786 AAAGCATCTTTTTCTCCTCAAGG - Intronic
1077148368 11:1056076-1056098 GCAGCAATCTGGTCCCCTCATGG + Intergenic
1077717868 11:4599845-4599867 GCAGCATTTTTTTGGCCTATTGG + Exonic
1078588802 11:12619837-12619859 GCAGCATTTATGTCCACTTAGGG + Intergenic
1078702482 11:13700233-13700255 TCACCATTTTTTTCCCACCAAGG - Intronic
1079336904 11:19577945-19577967 GCAGCATTTTGTTTTGCTCAAGG + Intronic
1079579379 11:22043903-22043925 CCATCATTTTTTTCTCCTCATGG + Intergenic
1079783289 11:24637551-24637573 GCTGAATTCTTTTCCCTTCAAGG + Intronic
1080607261 11:33873793-33873815 GGATCATTTTTTTCCCCTGTGGG + Intronic
1080722829 11:34866611-34866633 GCAGAATTTCTTCCTCCTCAGGG + Intronic
1081499578 11:43652976-43652998 GCAGCATTTTTTTTTCTTCCAGG + Intronic
1081601006 11:44494137-44494159 ACAGCATTTTTTTCCCACCATGG - Intergenic
1083878625 11:65537567-65537589 GCAGCAGTTTCTGGCCCTCAAGG + Intronic
1084361632 11:68672385-68672407 AAAGCACTTTTTTCCCCTCTAGG - Intergenic
1084842821 11:71870424-71870446 GCAGCAGGTTTCTCACCTCAAGG - Intronic
1084930006 11:72547566-72547588 GCAGCTTTCTTTTTTCCTCAAGG + Intergenic
1086399157 11:86446718-86446740 GCACCATTTTTGTCACCTCCTGG + Intronic
1087632771 11:100670220-100670242 CCAGCATTCTTTTTCCCTCTGGG + Intergenic
1091159502 11:133407075-133407097 GCAGTATATTTCTCCCCTCTAGG + Intronic
1093237901 12:16634675-16634697 GAAGTATTTTTTTTCCCTTAAGG + Intergenic
1093415867 12:18919948-18919970 GCAGAATTTTTTCTTCCTCAGGG - Intergenic
1093619246 12:21267218-21267240 GCATCACTTTTATCCCCTCATGG - Exonic
1098143926 12:67479375-67479397 GCAGAATTTCTTCTCCCTCAAGG - Intergenic
1098651950 12:72982462-72982484 GCAGCATTTTTTTCTGCTCGAGG - Intergenic
1099256347 12:80318163-80318185 GCAAGACTTTTTTCCCCTTAAGG - Intronic
1099686107 12:85891466-85891488 GCATCATTTTTTCCTCCTCTGGG + Intergenic
1101196776 12:102391715-102391737 GCAGCATTCTGTTCCCCTAGTGG - Intergenic
1101345839 12:103885362-103885384 TTAGCATTTTATTACCCTCAAGG + Intergenic
1102611873 12:114119496-114119518 GCAGCATTTTTTTGGACTCCAGG + Intergenic
1105570643 13:21600120-21600142 GCAGGATTTCTTAACCCTCATGG - Intronic
1106383042 13:29258376-29258398 ACAGCATTTTTTTTTCCTCCTGG - Intronic
1106878215 13:34099689-34099711 GCTGCTTTTTTTTTCCCTGAAGG - Intergenic
1107092321 13:36495325-36495347 GTATTATTTTTTTCCTCTCAAGG + Intergenic
1108108917 13:47046389-47046411 GCAGGATTTTGTTCCCGTTATGG + Intergenic
1108209512 13:48124167-48124189 GGAGCATTTTTTTCTCCTCCTGG - Intergenic
1108494602 13:51011996-51012018 TTATCATTTTTTTCCCTTCATGG + Intergenic
1109115119 13:58372440-58372462 TTAGCATTTTTCTCCCCTCAAGG + Intergenic
1109166999 13:59047810-59047832 GCAGGATTATTTTACTCTCATGG - Intergenic
1110047387 13:70847231-70847253 GCAGCATTCTTCTCCTCTGAAGG + Intergenic
1111923331 13:94435693-94435715 CCAGCCTTTTTTTCCACTCGGGG + Intergenic
1112391625 13:98990204-98990226 TCTGCATTTTTTTCCTCTTATGG - Intronic
1112712305 13:102143529-102143551 TGTGTATTTTTTTCCCCTCAGGG - Intronic
1113095666 13:106661533-106661555 GCAGATTTTTTTTCCTCTCCTGG + Intergenic
1114452439 14:22836258-22836280 TCAGCATTTGTCTCACCTCAGGG - Intergenic
1117090036 14:52240141-52240163 GCATCATTCTTTTGCCTTCATGG - Intergenic
1117370319 14:55072608-55072630 GAAGAATGTTTTTTCCCTCATGG - Intergenic
1119173690 14:72553858-72553880 CCAGCTTTTTTCTCCCCTGATGG - Intronic
1119765606 14:77185682-77185704 GCAGGATTGATTTCCCCACAGGG - Intronic
1120200874 14:81536973-81536995 GCAGAATATTTTTCCCTTCAGGG + Intergenic
1120275566 14:82369267-82369289 CCAGTATTTTTTTTCCCCCATGG - Intergenic
1122446182 14:101771170-101771192 AAAGCATTTTTTTCCCCTTCTGG - Intronic
1122738347 14:103856478-103856500 GCAGCCTTTTCTTCCTCACAGGG - Intergenic
1123929298 15:25153420-25153442 TTACCATTTTTTTCCCTTCATGG - Intergenic
1124224153 15:27875454-27875476 AAAGCATTTTTTTCCCCAAAAGG - Intronic
1124256932 15:28151970-28151992 GCACCATTTGTAGCCCCTCATGG + Intronic
1124567401 15:30828560-30828582 GCACCATTTGTAGCCCCTCATGG - Intergenic
1125247513 15:37658331-37658353 GCAGGATTTTTTTCTCCTTATGG - Intergenic
1126388008 15:48113642-48113664 GCAGTCATTTTTTCCCCTTAGGG - Intergenic
1127015447 15:54681101-54681123 GCAGCATTTTTTTTCCCTCAAGG + Intergenic
1127114397 15:55710419-55710441 GTAGCACTTTCTTCCCCCCAGGG + Intronic
1127560288 15:60129471-60129493 TCAGCAGTTTGTTCACCTCAGGG - Intergenic
1129128233 15:73464751-73464773 GCAGCATTGTCTTTGCCTCAGGG + Intronic
1130175130 15:81560521-81560543 TCATCATTTTTTTTCCCTTAAGG + Intergenic
1133251148 16:4482249-4482271 ACAGCATATTTTTCCCCTTCTGG - Intronic
1134112994 16:11527427-11527449 GCTCCTTTTTTTTCCCCTCTAGG - Intergenic
1134879073 16:17728459-17728481 GCAGCATTTTTAGCCCCACCTGG - Intergenic
1134885289 16:17785514-17785536 TCATCTTTTATTTCCCCTCATGG + Intergenic
1136996807 16:35196163-35196185 CCTGCTTTTTTTTTCCCTCACGG + Intergenic
1139493700 16:67301193-67301215 CCAGCTTGTTCTTCCCCTCATGG - Intronic
1140858608 16:78999951-78999973 GGAGCATTTTTTTTTCCTTAGGG + Intronic
1142580312 17:937911-937933 GCAGCGTTTTTCTTCCCTCGTGG - Intronic
1142877091 17:2857743-2857765 GCTGCCTGTTTTCCCCCTCAGGG - Intronic
1144402354 17:14918468-14918490 GGCCTATTTTTTTCCCCTCATGG + Intergenic
1146019668 17:29266752-29266774 GAATGATTTTTTTCCCCTCCTGG - Intronic
1149157844 17:53654480-53654502 GGAGAGTCTTTTTCCCCTCAGGG - Intergenic
1150562560 17:66305901-66305923 GCAAGATTTTTTTCCCCCCAAGG + Intronic
1153233862 18:2967285-2967307 TCAGATTTTTTTTGCCCTCAGGG - Intronic
1153606039 18:6834172-6834194 GCAGAATTTTTTTTCTCTCAAGG + Intronic
1155464261 18:26118406-26118428 GTAGCTTTTTTTTTCCCTCATGG + Intergenic
1156001411 18:32388821-32388843 GCTGCATTTTTTCCGCCTCTGGG - Intronic
1157314923 18:46579237-46579259 GCAGCATCTTTCTTACCTCAGGG - Intronic
1157619547 18:49008452-49008474 GCAGCCATTCTCTCCCCTCAGGG - Intergenic
1158078486 18:53560763-53560785 GCAGAATTTTCTTCCCTTCAGGG - Intergenic
1158653602 18:59308808-59308830 GCAGCCTCTTTTTCGCCACATGG + Intronic
1158688815 18:59641890-59641912 GCTGCGTTTTCTTCCCCTTATGG - Intronic
1160022085 18:75188940-75188962 GCAGCATCTTTTACCCCTTGGGG + Intergenic
1164702668 19:30296838-30296860 GCAGCATCCTTTCGCCCTCATGG + Intronic
1168134655 19:54342238-54342260 CCACCATTTTATCCCCCTCAGGG + Intergenic
925096127 2:1205181-1205203 CCAGCATTTTTGCCTCCTCAAGG - Intronic
925559490 2:5174619-5174641 TCAGCATTCTTTTCACATCAAGG + Intergenic
925832070 2:7905592-7905614 GTAGCATTTTATTCCACTCTAGG + Intergenic
926722718 2:15973419-15973441 GCTGCATTTGTGTCTCCTCAGGG + Intergenic
926887215 2:17609276-17609298 GGAGCATGTCCTTCCCCTCAGGG + Intronic
927644089 2:24864535-24864557 TCAGCATTTCTTTCCCGTTAAGG - Intronic
931943444 2:67278559-67278581 CCAGCATTTATTCTCCCTCAAGG - Intergenic
932139119 2:69260123-69260145 GCTGAATTCTTTTCCCCGCAAGG + Intergenic
935193095 2:100793894-100793916 TTTTCATTTTTTTCCCCTCATGG - Intergenic
935261354 2:101358443-101358465 GTAGTATTTTTTTACCCCCAAGG - Intronic
937076941 2:119113973-119113995 CCAGCATTTGTCTCCCCTCCAGG + Intergenic
937856051 2:126672671-126672693 GCAGCAACCTTCTCCCCTCAGGG + Intronic
938593213 2:132760598-132760620 GAGTCATTTTTTCCCCCTCATGG + Intronic
938705570 2:133921744-133921766 GCATCAATTGTTTACCCTCATGG - Intergenic
941218508 2:162744378-162744400 ACAGCCTTTCTTTTCCCTCATGG + Intronic
945320879 2:208422150-208422172 GCACCCTTTTTTTCCCTTCCTGG - Intronic
947368372 2:229419828-229419850 GCAGCAATTTTGTCCCCCAAAGG + Intronic
948072936 2:235141973-235141995 GCAGAATTTCTTCCTCCTCAAGG - Intergenic
1168850950 20:976658-976680 CCTGCATTTTTGACCCCTCAGGG - Intronic
1169409032 20:5351459-5351481 TCACCATTTTTTTCCCCTAGAGG + Intergenic
1171073522 20:22099208-22099230 TCAGCAGCTTTTTCTCCTCATGG - Intergenic
1171989614 20:31685728-31685750 GCCCTTTTTTTTTCCCCTCAAGG + Intronic
1172323313 20:34014596-34014618 ACAGAATTTTTTTTCCCTGAGGG - Intronic
1172414598 20:34754463-34754485 GCAGTATTTTTTTTCTCTGAAGG - Intronic
1173020438 20:39263329-39263351 GCAGCACTTTTTTCACAACATGG - Intergenic
1174566498 20:51468642-51468664 GCAGCCTTTTTCTCCCCACTGGG + Intronic
1177947067 21:27483723-27483745 TCAGCATTGTTTTCCTCTAATGG - Intergenic
1179029906 21:37711609-37711631 GAAGCATTTTTCTCCCCTAAGGG + Intronic
1179187186 21:39093999-39094021 GCAGCTTCTTCTTCCCCTGATGG - Intergenic
1180611044 22:17098189-17098211 CTTGCTTTTTTTTCCCCTCAGGG - Intronic
1180617846 22:17140269-17140291 GCAGCCCTTTTTTGGCCTCAGGG - Intronic
1183420406 22:37708709-37708731 GGAGCATTGTTTTCTCCTCTCGG - Intronic
950882081 3:16330052-16330074 CAAACATTTTTTCCCCCTCAGGG + Intronic
951293803 3:20907810-20907832 GGTTCATTTTTTTCCCCTTATGG - Intergenic
951823220 3:26837455-26837477 GGAGCATCTTTATTCCCTCAAGG - Intergenic
953663152 3:44905694-44905716 ACAGCATTTTTTTGCCTTCAGGG - Intronic
955766891 3:62354286-62354308 CCATCTTTTTTCTCCCCTCATGG - Intergenic
958927617 3:100176158-100176180 GCTGCATTTGTTTTCCATCAGGG + Intronic
959338843 3:105101812-105101834 GCTGCATTCTTTTCCTCCCATGG - Intergenic
959891815 3:111564971-111564993 CCAGCAGTTTTTTCTCCCCATGG + Intronic
961930813 3:130530847-130530869 GCAGAATTTCTTCTCCCTCAGGG - Intergenic
961959456 3:130839268-130839290 GCAACACTTTTTTCACCTCAGGG - Intergenic
963227025 3:142872683-142872705 GCAAGATTTTTTTTCCCTTAGGG - Intronic
963357093 3:144222057-144222079 GCAGTTTTTTTTTCTCCTCCTGG - Intergenic
963964373 3:151349244-151349266 GCACCATTTTTTTCCCCACGTGG - Intronic
964806716 3:160618238-160618260 GCAGCATAATTTTCCCCTCACGG - Intergenic
966970463 3:185040838-185040860 GAATCATTTTTTTCCTCCCAAGG + Intronic
967672831 3:192259574-192259596 AAAACATTTTTTTCCTCTCATGG - Intronic
968174048 3:196533651-196533673 GCTGCATTCTTTTCCCAGCAAGG - Intergenic
968444183 4:640558-640580 TTAGCATTTTTTTTCCCTCATGG + Intronic
970797074 4:19925750-19925772 GCACCATTTTTTTTTTCTCATGG - Intergenic
971499008 4:27298783-27298805 GTACCTTTCTTTTCCCCTCAAGG - Intergenic
971971520 4:33626490-33626512 GCAACGTTTTTTTCCCCACAGGG - Intergenic
972756438 4:42053026-42053048 GAACCAGTTTTTTCCCCCCAAGG + Intronic
973129720 4:46635828-46635850 GCAGCAGTTTTCTAACCTCAAGG - Intergenic
973188208 4:47355745-47355767 GCAGAATTATTGTTCCCTCAGGG - Intronic
973833832 4:54789471-54789493 CTGGCATTTTTCTCCCCTCAGGG + Intergenic
974240710 4:59242721-59242743 GCTTCATTTTTTTCCTGTCAAGG + Intergenic
976989002 4:91340394-91340416 GAAGAATTTTTTTCCCCAGAGGG + Intronic
977451959 4:97210335-97210357 AGAGATTTTTTTTCCCCTCAGGG - Intronic
980581175 4:134753565-134753587 TCAGCATTTATTTTCACTCAGGG - Intergenic
980754825 4:137144702-137144724 TCAACATTTTTTTTTCCTCAAGG - Intergenic
980975445 4:139606135-139606157 GCTGCATTTGTTTCCTCTCGAGG - Intronic
982014239 4:151137148-151137170 CCAGAATTTTTATACCCTCACGG - Intronic
982388285 4:154836639-154836661 GCAACATTCTTTTCCAATCAAGG + Intergenic
983418461 4:167488014-167488036 GTCTCATTTTATTCCCCTCAAGG - Intergenic
983489773 4:168375005-168375027 CTGGCATTTTTTTCCCCTGAGGG - Intronic
984643311 4:182194751-182194773 CAAACATTTTTTTCTCCTCACGG + Intronic
984833708 4:183999755-183999777 GCAGCAAGTTTTTCCCCATAGGG + Intronic
985938620 5:3116049-3116071 GTAGCATGTTTTTCCCGTCCTGG - Intergenic
987982236 5:25100733-25100755 GCAGAATTTATTTTTCCTCAGGG + Intergenic
988370875 5:30365576-30365598 GTAGCATGTTCTTCCCCACAGGG + Intergenic
989452576 5:41604290-41604312 GGAACATTGCTTTCCCCTCAAGG - Intergenic
990178334 5:53132114-53132136 ACATTATTTTTTTCCCCTTAGGG - Intergenic
991152287 5:63384559-63384581 GATGCATTTGTTTCCCATCAAGG + Intergenic
993316711 5:86416507-86416529 GCAGTATATTTTTCCCCCAAAGG - Intergenic
993834152 5:92795914-92795936 GCTGAATTTTTTTCCCAGCAAGG - Intergenic
994154088 5:96482838-96482860 ACAGGATTTTTTCCCCGTCATGG - Intergenic
995984368 5:118151408-118151430 TGAGTATTTTTTTCCCCTAAAGG - Intergenic
996002283 5:118378722-118378744 TCAGCCTTTTTTTCCCCTCCAGG - Intergenic
996706186 5:126501294-126501316 GAAACATTTATGTCCCCTCATGG + Intergenic
997073573 5:130645513-130645535 GATGCATTTTTTTTCCCTAAAGG - Intergenic
997442536 5:133918924-133918946 GCCGCATTCTCATCCCCTCAGGG + Intergenic
998743852 5:145234503-145234525 GCAACATTTTTTACCGCTCTGGG - Intergenic
999015801 5:148103515-148103537 GCAGCATTTTCTTTCCCCAATGG - Intronic
999354656 5:150914880-150914902 GCAACATTCTTTTCCAATCAAGG + Intergenic
999505072 5:152186136-152186158 TCAGCAATTTTTTCCCCTGGCGG + Intergenic
999840256 5:155417133-155417155 GCAGCATTTATTTCTCTTGATGG + Intergenic
1000066345 5:157695860-157695882 GGAGCTTTTTCTTCCCCTAAAGG + Intergenic
1000164352 5:158633361-158633383 GCTGCCTTATTCTCCCCTCACGG + Intergenic
1000228296 5:159291057-159291079 CCTTCATTATTTTCCCCTCAGGG - Intergenic
1000652809 5:163837856-163837878 GAAACCTTTTTTTCCTCTCAAGG + Intergenic
1001041335 5:168337744-168337766 GCACCATTTTATTTCCTTCATGG - Intronic
1001377758 5:171278949-171278971 GCAGGGATATTTTCCCCTCAAGG - Intronic
1002471848 5:179440160-179440182 GGAGCATTTTAATTCCCTCATGG + Intergenic
1003962615 6:11222950-11222972 GGAGGATTTTTGTCCCCTCTGGG + Intronic
1003970794 6:11297252-11297274 GCAGCATTCTTTTCCCAGGATGG - Intronic
1004286931 6:14329867-14329889 GAAGCATTTATTTCCCTTCAGGG - Intergenic
1005637891 6:27768561-27768583 GCAGCCCATTTTACCCCTCAAGG - Intergenic
1007413361 6:41677965-41677987 TCAACATTTTCCTCCCCTCATGG - Intergenic
1008646375 6:53519005-53519027 GCAGCCCTTGTCTCCCCTCAGGG + Intronic
1008861897 6:56158872-56158894 TCAGCATTATTTTCCCCCCTTGG - Intronic
1009226497 6:61024672-61024694 ATAGCATCTTTTTCCCCTCTAGG - Intergenic
1009492048 6:64303293-64303315 GCAACATTCTTTTCCAATCAAGG - Intronic
1009617512 6:66029498-66029520 GGAGCATTTTTTTTCACTAAAGG - Intergenic
1009813176 6:68695756-68695778 CCAGCATTTTGATCCCATCAAGG - Intronic
1009926371 6:70125807-70125829 TGAGCATATTCTTCCCCTCAAGG + Intronic
1011266541 6:85526173-85526195 GCAGACTTTCTTTCCCCTAATGG - Exonic
1012279138 6:97308529-97308551 GAATACTTTTTTTCCCCTCATGG - Intergenic
1012386756 6:98691534-98691556 GCAGCTTTTGTTTCCCCAGATGG + Intergenic
1013743982 6:113322705-113322727 TCAGCAGTTTTTTCCCCTTCTGG - Intergenic
1013771335 6:113631255-113631277 GAGGCATTTTTTTCCCCTTCTGG - Intergenic
1014898465 6:126933027-126933049 TCAGCATTTTTTTCTCTTCTAGG - Intergenic
1016566811 6:145464493-145464515 GATACATTTTTTTCCCATCATGG - Intergenic
1018704392 6:166451910-166451932 GCAGATTTTTTTTCCCCACGAGG - Intronic
1019982575 7:4632199-4632221 GCACCACATTTTGCCCCTCACGG - Intergenic
1020585607 7:10062174-10062196 CCAGCAGTGTTTTCCCCTCTAGG + Intergenic
1021703037 7:23338762-23338784 AAAACATTTTTTTCCCCTTAAGG + Intronic
1021998833 7:26205363-26205385 GAAGGATTTTTTTCACCTTAGGG + Intronic
1022220869 7:28312278-28312300 GCAGCCTCTTTTTCTGCTCATGG + Intronic
1024218465 7:47267702-47267724 GCTTCATTTTTTTCCCCTAAAGG - Intergenic
1024563994 7:50666547-50666569 GCAGCATTTGTGGGCCCTCACGG - Intronic
1028669769 7:93387951-93387973 GCAGAACTTTTATCCCCACAGGG + Intergenic
1028918289 7:96284186-96284208 ACAGTATTTTTTTCTCCTAAGGG + Intronic
1029234400 7:99101631-99101653 GTATCATTTTTTTCCCTTGAGGG - Intronic
1030958218 7:115881950-115881972 GCACTATTTTTTTCCCTTTATGG + Intergenic
1032326290 7:130931871-130931893 GTAGCATTTTTTTCCCCTTGAGG - Intergenic
1033322121 7:140349428-140349450 GCAGCATTTTTTTCCCCTCAAGG - Intronic
1033463887 7:141573040-141573062 GGAGGTTTTTTTCCCCCTCATGG + Intronic
1035543934 8:464355-464377 TCAACATTTTTTTTCCCCCACGG - Intronic
1036570230 8:9973990-9974012 GAAACTTTTTTTTCCCCTTAGGG + Intergenic
1036835125 8:12057637-12057659 GCAGCAGGTTTCTCACCTCAAGG + Intergenic
1036856968 8:12304201-12304223 GCAGCAGGTTTCTCACCTCAAGG + Intergenic
1038005028 8:23422662-23422684 GCAGCAATTTTTTTCTCTAAAGG - Intronic
1039100872 8:33940696-33940718 GCTGCTTTTGTTTCCCCTCAGGG + Intergenic
1039141587 8:34395576-34395598 TTTTCATTTTTTTCCCCTCAAGG + Intergenic
1040359998 8:46656049-46656071 GCAACATTATTTTCCAATCAAGG - Intergenic
1041152398 8:54948961-54948983 GCACCATTTTCTGCCTCTCATGG - Intergenic
1043204024 8:77412571-77412593 TCAGCAATTTTGTTCCCTCAAGG - Intergenic
1043559094 8:81469663-81469685 GGAACATTTTTTTCTCCCCAAGG - Intergenic
1044053039 8:87533579-87533601 TGAGCATTTTTTTTCCCTCCAGG + Intronic
1044063145 8:87664220-87664242 GTAATATTTTTTTCCCCTAATGG - Intergenic
1044917114 8:97126959-97126981 GGTTCATTTTTTTCCCCTTAAGG - Intronic
1045168945 8:99642223-99642245 GCAGCATTTCTTTTCCTTCAGGG + Exonic
1046661999 8:116957866-116957888 GCACCAGCTTTTTCCCTTCATGG + Intronic
1047651809 8:126931266-126931288 GGTACATTTTTTTCCCCTCCAGG - Intergenic
1047819986 8:128508528-128508550 GCAGGATTTTTTTCCCTATAAGG + Intergenic
1051007433 9:12363629-12363651 TCAGCATTTTTTAACCCTAATGG + Intergenic
1051459869 9:17299842-17299864 GAAACATTTTTTTCCCCTCTTGG + Intronic
1051486710 9:17616325-17616347 GCTGCATTTTTTTCCATTGAGGG + Intronic
1052030924 9:23627902-23627924 GAAGCATTTTTTTCCCCAATTGG - Intergenic
1052182336 9:25545212-25545234 GCAGCATTATCTTTCCATCAGGG - Intergenic
1052538002 9:29772660-29772682 GCATTTTTTTTTTCCCCTAAGGG - Intergenic
1053167330 9:35853859-35853881 GAAGCATTCATATCCCCTCAGGG - Exonic
1055196298 9:73598648-73598670 GAGGCAATTTTCTCCCCTCAGGG + Intergenic
1055601272 9:77921451-77921473 ACAGCATTTATTTTCACTCAGGG + Intronic
1056675683 9:88675138-88675160 GCAGAATTTCTTCCTCCTCAGGG - Intergenic
1057933665 9:99218503-99218525 GCAGGAATTTTTTCCCCTTGGGG + Exonic
1058268869 9:102943619-102943641 TCAGAGTTTTTTTCACCTCAGGG - Intergenic
1059388013 9:113980249-113980271 GCAGAATTGTTTTCCTCTCTTGG + Intronic
1059699786 9:116764060-116764082 GGTGCATTTTTTTCACCTCATGG + Intronic
1061511660 9:131065090-131065112 GCAGCATTCTTGTCACCTCCAGG + Intronic
1061619061 9:131799113-131799135 GCACCATGTTTATCCACTCATGG - Intergenic
1062438469 9:136557503-136557525 GCAACATTTTTTTCACCTCAAGG + Intergenic
1186814978 X:13227421-13227443 ACTGTTTTTTTTTCCCCTCAAGG + Intergenic
1186877981 X:13835724-13835746 ACAGGATTTTTTTCCAGTCATGG + Intronic
1187970817 X:24656156-24656178 CCATTATTTTTTTCCCCTAATGG - Intronic
1188303180 X:28530386-28530408 GAAGGATTTTTTCCCCCTTACGG - Intergenic
1191634186 X:63358640-63358662 GCAACATTCTTTTCCAATCAAGG + Intergenic
1192112090 X:68375450-68375472 AGATCATTTTTTTCTCCTCAGGG - Intronic
1193032014 X:76908382-76908404 GCAGCAGTTTCTTAACCTCAAGG + Intergenic
1193441665 X:81547911-81547933 GCAGTATATTCTTCACCTCATGG + Intergenic
1194143438 X:90234191-90234213 GCAATATTTTTTTTTCCTCAAGG + Intergenic
1194327715 X:92540783-92540805 GAAGTGTTTTTTTCCCTTCAAGG + Intronic
1196044584 X:111244378-111244400 ACTGCTTTTTTTTCCCCCCAAGG - Intergenic
1196361413 X:114865247-114865269 GCAGCATAGTATTCCACTCATGG + Intronic
1197703808 X:129619314-129619336 GCAGCAATGTTGTCCCCTGATGG + Intergenic
1198978244 X:142361901-142361923 GCAGAATTTCTTTTTCCTCAGGG + Intergenic
1199219813 X:145305352-145305374 GCTGAATTTTTTTCTCCTCTGGG + Intergenic
1200291247 X:154876446-154876468 GTAGCATTTTTTTCTTCCCAGGG + Intronic
1200489192 Y:3803512-3803534 GCAATATTTTTTTTTCCTCAAGG + Intergenic