ID: 1033322122

View in Genome Browser
Species Human (GRCh38)
Location 7:140349444-140349466
Sequence ATGCTGCAGCTGCATGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033322118_1033322122 6 Left 1033322118 7:140349415-140349437 CCTCGTGGCTCTCCCTTGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1033322122 7:140349444-140349466 ATGCTGCAGCTGCATGAAGATGG No data
1033322120_1033322122 -6 Left 1033322120 7:140349427-140349449 CCCTTGAGGGGAAAAAAATGCTG 0: 1
1: 0
2: 2
3: 20
4: 293
Right 1033322122 7:140349444-140349466 ATGCTGCAGCTGCATGAAGATGG No data
1033322121_1033322122 -7 Left 1033322121 7:140349428-140349450 CCTTGAGGGGAAAAAAATGCTGC 0: 1
1: 1
2: 2
3: 30
4: 289
Right 1033322122 7:140349444-140349466 ATGCTGCAGCTGCATGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033322122 Original CRISPR ATGCTGCAGCTGCATGAAGA TGG Intronic
No off target data available for this crispr