ID: 1033324358

View in Genome Browser
Species Human (GRCh38)
Location 7:140365100-140365122
Sequence GACAATAATTAGCTGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033324349_1033324358 23 Left 1033324349 7:140365054-140365076 CCTTGGGTTTCATGACATCCCAA 0: 1
1: 0
2: 1
3: 9
4: 136
Right 1033324358 7:140365100-140365122 GACAATAATTAGCTGGAGACAGG No data
1033324348_1033324358 24 Left 1033324348 7:140365053-140365075 CCCTTGGGTTTCATGACATCCCA 0: 1
1: 0
2: 2
3: 22
4: 239
Right 1033324358 7:140365100-140365122 GACAATAATTAGCTGGAGACAGG No data
1033324354_1033324358 5 Left 1033324354 7:140365072-140365094 CCCAAGGCAGGGAGAGTAGGAAG 0: 1
1: 0
2: 6
3: 48
4: 478
Right 1033324358 7:140365100-140365122 GACAATAATTAGCTGGAGACAGG No data
1033324355_1033324358 4 Left 1033324355 7:140365073-140365095 CCAAGGCAGGGAGAGTAGGAAGG 0: 1
1: 0
2: 3
3: 53
4: 509
Right 1033324358 7:140365100-140365122 GACAATAATTAGCTGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033324358 Original CRISPR GACAATAATTAGCTGGAGAC AGG Intronic
No off target data available for this crispr